ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:04:03 11:20:45 "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?ıf%ɁGZ`yUJZNqO=S 1mÀ~7]K7 rCX'$7uSEvr ;o{>*u|Vc)hs6=ԅQ%Xr4t} }$VֹQ\Zi۱-v}_U0ZK Z^^/Gu:~dnjbTFNJX H^*]RcCj%k̭w~= izk?KOY:^a":Ɨ@Nԋ ,'9v8ieYC7=45q ,#vm~f}MqinWV͞HPÎ~"`cՏ)~ 11N/~0K{5ÀmZ7m`8]~B>g @2[whp"v?EUoKw~+05nZYCA#sy!xKR#W`Nmi^Olzj$ kAk!(։uTe!V)˦,yi*Ͼm}Ine,bɐg"yKSI>!) #%XI\p;NQRt+e]M,6d4kß.mERp e@+e{cmt%zѵz %s._mY9C':f=?!}5RMeK,#-#g#/bFYe\9+0C~Gۃݜ5->Oo)e[kcip}:?U{3uL{3Wes=:ri~k1/x[떶42]g4NC%Ë (<}1J/V(k}RHYȣQl9Lelp{ n>/r?f4{,#V"͛n(5?2v ~ȍz궯GE/G)ehKEN)mmdVѻs?za;C5OgI pr2C)d[(Hp_z 3t~UKhQuy<ǯ];}-gJ?Nrw,rÌ*_GwNCsl*}Zmش9;ʺ;O*ʛ, c:'E.!ЍirP*e8UV1},,흮||f5߳wH>ߣ.c.Tɏ(2Lpc̀@;۽v[}kԯ}YnOG1iP v,mj֜[ /cl.s潐{{j:^Fms{+%ofzz_f2׫9(K&Z]&ΗҲjn=ϻ"ikGW3(|{.cjgn7[=#u7jN%ٸk>~lcѿ׳ }Phy}@A8zm)ъ\2iqK'=;޻Eb깕= @`sncsgc|mO潥59\˝Mk}cXOReK^ح̑5~ӏw_Cޝ_i1^m-Hiqi퍦r+b32CspvCH[4jz7En-s`7SW7OW[-./U][˟7<'hD$n@F0Fd|2R1c h%y=#O3ң Jud9Bpð*` $}D TN?W2\ 5~9U2l\XX=0gk;?IC{EeM``3&[gRD&y7:E}gRZ"?s5Gע6_ !j>Z 7S,LqZZ[:)uз'==@-vNڷ{PjQsKAUH;'})dQ wi/s(An=Z[P^DFvI|l FCk9ԟ՝]6pZ5k]8P{ CVI(rU7c8YC19wlmvgE# ]ߴۚN=OI,+u \{Z3q)emcZ[ U}W?QP6Sk~V@4}ߕѯuA7cZ= z ]=Ѯ¥̲nZ͵}uPT_ dӰHʛ9 }!;\jeU<'ǨY? e.7 Wk2PSk̭ؗWZzs7pc=[?S0G[:Gkma8n ӻw3;k5tR_fs.(8Qy:t?Piahcpc7rn>ܧ3n` 0 si?Yl3c;dpqݵX7Wvr$-%ڍ(V2ח-ncZ@oR&1[}'3s[Y}?%{iXs$8?pLJ;i5ϑ#[}Fz)wKc&KI_Ȕj_CZVVC.h0DHk$4@.2L~9Fqu׼WS5s@4D;2k]6Z NS v\ǒN|ZׁcgX6iZnvV&Sckc {5r͞ũ!kn.[Wo^Ε`7-vC[8l;dQzߛc\ 7?Gae.ݱJ_eTׁ-%s8kN%lUWˊZX:tt@1zJv>>Sn.;M>->Aƪ:|{Ʌwtn}70};qr?k;!05d&Ǘ q+|єD/uMvc6Xe"py.1\Auh3bپ8Ao&b$K)I%3)I$T~K?0WU^rI܃?v3.MGYAB?N.1)ɸ[e4mEX~߸:$Aj,|.jsqka4;2Gn,Ψ:g ]~Ƕu*1uvz힥WG;l\W jg̃k]kv?X쨗閂$F_Fa*_2~UV籮sqy|该YBI-`v՟WAu0a;A${4ٲv'Ċr&ƶuceMۘ=[,pv9O:YF{@n6=ncks5gԦ+ǩ{[ kZm%A<ςlj}:trv5݉gm?-;3&ns>;mw9[\ 6 T|2.ICBc/9qzo,oeM'CwrvE,9G99vw}^sM]F$9cںѩ@htwx'b~*^aˋQ}E0ֆ+6ǏuC I;u{JҠpū7}:\=7Kֻl?}4֎?N/$%hw.Wߧ>>t~Պ#E4ڜoqIyI}ʾ?0blph9?X:VF=ecݮ-;7_%X YcoXViq-?Ar q,.S#^ Nْlji{du[.m%}+7Y!C(DWOXru :ݠIBXLmh}$'[~S iӋU:痻RNu)#94kۺq/Q I.~fr:0vsNKFfmRj0_O!,D޻CH1C)#Xc C`M7&3=e mG wh? ޺ϘvGz&;I jc}a#޻ #4{yZZYG:,mb7LL}s~m ۷tc>'<%]WgUl֚\֖ HzRO1݌@\zKm%Ǥ%Ǥ59r v>I7gm'\zI \zH\zI)\zI)\zI)\zH)"~Photoshop 3.08BIM:Z%G&Burgenhotels Prospekt 2018-2019 g.indd8BIM%n= *u|Vc)hs6=ԅQ%Xr4t} }$VֹQ\Zi۱-v}_U0ZK Z^^/Gu:~dnjbTFNJX H^*]RcCj%k̭w~= izk?KOY:^a":Ɨ@Nԋ ,'9v8ieYC7=45q ,#vm~f}MqinWV͞HPÎ~"`cՏ)~ 11N/~0K{5ÀmZ7m`8]~B>g @2[whp"v?EUoKw~+05nZYCA#sy!xKR#W`Nmi^Olzj$ kAk!(։uTe!V)˦,yi*Ͼm}Ine,bɐg"yKSI>!) #%XI\p;NQRt+e]M,6d4kß.mERp e@+e{cmt%zѵz %s._mY9C':f=?!}5RMeK,#-#g#/bFYe\9+0C~Gۃݜ5->Oo)e[kcip}:?U{3uL{3Wes=:ri~k1/x[떶42]g4NC%Ë (<}1J/V(k}RHYȣQl9Lelp{ n>/r?f4{,#V"͛n(5?2v ~ȍz궯GE/G)ehKEN)mmdVѻs?za;C5OgI pr2C)d[(Hp_z 3t~UKhQuy<ǯ];}-gJ?Nrw,rÌ*_GwNCsl*}Zmش9;ʺ;O*ʛ, c:'E.!ЍirP*e8UV1},,흮||f5߳wH>ߣ.c.Tɏ(2Lpc̀@;۽v[}kԯ}YnOG1iP v,mj֜[ /cl.s潐{{j:^Fms{+%ofzz_f2׫9(K&Z]&ΗҲjn=ϻ"ikGW3(|{.cjgn7[=#u7jN%ٸk>~lcѿ׳ }Phy}@A8zm)ъ\2iqK'=;޻Eb깕= @`sncsgc|mO潥59\˝Mk}cXOReK^ح̑5~ӏw_Cޝ_i1^m-Hiqi퍦r+b32CspvCH[4jz7En-s`7SW7OW[-./U][˟7<'hD$n@F0Fd|2R1c h%y=#O3ң Jud9Bpð*` $}D TN?W2\ 5~9U2l\XX=0gk;?IC{EeM``3&[gRD&y7:E}gRZ"?s5Gע6_ !j>Z 7S,LqZZ[:)uз'==@-vNڷ{PjQsKAUH;'})dQ wi/s(An=Z[P^DFvI|l FCk9ԟ՝]6pZ5k]8P{ CVI(rU7c8YC19wlmvgE# ]ߴۚN=OI,+u \{Z3q)emcZ[ U}W?QP6Sk~V@4}ߕѯuA7cZ= z ]=Ѯ¥̲nZ͵}uPT_ dӰHʛ9 }!;\jeU<'ǨY? e.7 Wk2PSk̭ؗWZzs7pc=[?S0G[:Gkma8n ӻw3;k5tR_fs.(8Qy:t?Piahcpc7rn>ܧ3n` 0 si?Yl3c;dpqݵX7Wvr$-%ڍ(V2ח-ncZ@oR&1[}'3s[Y}?%{iXs$8?pLJ;i5ϑ#[}Fz)wKc&KI_Ȕj_CZVVC.h0DHk$4@.2L~9Fqu׼WS5s@4D;2k]6Z NS v\ǒN|ZׁcgX6iZnvV&Sckc {5r͞ũ!kn.[Wo^Ε`7-vC[8l;dQzߛc\ 7?Gae.ݱJ_eTׁ-%s8kN%lUWˊZX:tt@1zJv>>Sn.;M>->Aƪ:|{Ʌwtn}70};qr?k;!05d&Ǘ q+|єD/uMvc6Xe"py.1\Auh3bپ8Ao&b$K)I%3)I$T~K?0WU^rI܃?v3.MGYAB?N.1)ɸ[e4mEX~߸:$Aj,|.jsqka4;2Gn,Ψ:g ]~Ƕu*1uvz힥WG;l\W jg̃k]kv?X쨗閂$F_Fa*_2~UV籮sqy|该YBI-`v՟WAu0a;A${4ٲv'Ċr&ƶuceMۘ=[,pv9O:YF{@n6=ncks5gԦ+ǩ{[ kZm%A<ςlj}:trv5݉gm?-;3&ns>;mw9[\ 6 T|2.ICBc/9qzo,oeM'CwrvE,9G99vw}^sM]F$9cںѩ@htwx'b~*^aˋQ}E0ֆ+6ǏuC I;u{JҠpū7}:\=7Kֻl?}4֎?N/$%hw.Wߧ>>t~Պ#E4ڜoqIyI}ʾ?0blph9?X:VF=ecݮ-;7_%X YcoXViq-?Ar q,.S#^ Nْlji{du[.m%}+7Y!C(DWOXru :ݠIBXLmh}$'[~S iӋU:痻RNu)#94kۺq/Q I.~fr:0vsNKFfmRj0_O!,D޻CH1C)#Xc C`M7&3=e mG wh? ޺ϘvGz&;I jc}a#޻ #4{yZZYG:,mb7LL}s~m ۷tc>'<%]WgUl֚\֖ HzRO1݌@\zKm%Ǥ%Ǥ59r v>I7gm'\zI \zH\zI)\zI)\zI)\zH)8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ Burgenhotels Prospekt 2018-2019 g.indd ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$S]JjCʞ=i+~nG177'{|h(@bÍxV"wP=Zk[[=-Wۀc֫ߗr  {ysZ[Ѝ9 qEt=Z7:j+. 'W{sZ/ydsUt+G'Sb4on-(C 543)Y>:Ŏԇ5 =HFm\|EDB}6lV+Tą^"])b/'mBDO'\cWS-)}9n 8)Sn*JaI,v՘aV4L:E=GQc41aȱyH`{7@XӸŒYk u^Xª}X=BŨV{}G ~{hWޟe'DNE?&CuF&o _ch&a1?Lǜ&ɑE"si „Ub%&kx]B?&k2l ,/4TE';A-ql.T"WhE8%dmnCjI "o1n, b+e< jrӜ1 rVɴVxEWH5#Nq46ִW~xiψ<ު&Ɯ.äSk:V8_:4RRU=ٯ I lyȉs×ESHses(dQ k]_0li",;3f.1Ry{ncfVZpBPqzW/[iq)tF3Bw<4:|R:xg,ԈgK( eF4VU ٯb;(4)PTjv6#qԹڛ:|/<ʗ͈m8T]<ǰN%[d[P>4DSuv3ᕬ£rQ$5j^v[><>]N$\(KVIʑSJ@@݁CZQmֽ]0YO@<v v*r-' OݺG}LHZ{gtƕvۧ*N=<o{*ˉa Y#GW-PqMݩaQ*0J3#DZ9WzcǏĿqϝ*n}<'{2[~jX%īGd_qOz*|GIM,4`xs7FYN.|oE/壎Ξ*lfN3KO ;%aPO,|Cgo, ^Fs6-|@q*rInT6[]OҖx;{>-+Sx0ac̔-WE_+I!u L5"OWr oܤOe V,h׼8S%oogk*J|x,1e>#[">$s+D$J.o*E{RjG Jh+k$zꕀ0]F؍Pi"Fd /`mJ=E=ynu.q3*J[PFڋ:2am:}2h0F+:eEĞ~.BR6B!`]<5%Y}PS*jC&~Hށ>4UNV&v.9Fj÷JAՁl[vvk^2ɅSxx"%t@8-:ONDR§$mk( MqiE<̣Qz+Q>b3k:2||>Snʾ͵zya#T:rkf6nk\Oo&/FEusT6榽㜶jj^9MZ+әlNa,:^޷%S^x={x{=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עs=5oMz+=^l<עsС~sF][\s#UrTjTЏψΡ>=?f܏Vu$O4/߃@!B tַ4M̖+W}mu[t+[0/T".s\uX|1$j+,<9hAZ+[ Z"V@NZj\y׷/U^j^d_Wn0lWDs+[7L/z+>0{rvo̊\Jf =)1Xʆ' J{nM(MF4p]Ɯu1UJ }N#]•hQ%i%_H3JWCn[G c S}#4&UBYXvo1O\Z+KO %}Oį,8)w"+Uo=:G}-jspm{43u ÉXNPg ebpv$wקU6GXLbX,ǝ<1>Tx%od0ׇ,wc4Bn/Vo@4*eV ҢHAŽUbJH.tW:p$Qy1v%Hߡfޟ:dL,uawk(7=4/㴄;oPtSq, `5\E>qq KoA%A'[SEVNStPŨ.č:v 1F4$BO pE)Xqp8&"wAT9B8橦d[ۖW;A5榭0⺿8ss^^ 9^kU{MuZq;szZk<%>(zi5{{n9R)QnW]8"((7@qLJ`7_[6${(.5i|+%;nJx>`]kp=ۍw]W4~Ε迂@L-( 阐{coaū6 cu@OyƓ6¤TTt}?|YwȰUuohA?MciqZ2UKُr{}Dqz "΅dx%D Sd;i:1,Mu&GH uBjgm}}OỀ ϣ%[p>CJ8O¢EWbbT!$y^hvmsyzty&}{-ٹJp2]T[)X#6)O*L7= ~}-E+[qXp/aH>-*"^ ˋh|9mUMm&㝼{oK8 lպ t["Z& ƨ1"w)|D,,2Ӝ)ju5Z.pnR4' 2>%FoM8<* tm\ei5Qige_:eZඬd[C*R˛GE2$d)̇/׶驶 {ߕFA~YGuWS $׎N0kJw W`AĬ+3Hz~1&)08p;^q`B{hBf'uxDͶx>Gd+:WHP׿N5,H u:F`X%[XDF5> p:"cLqꐞ @`k~h2K/Y3irA];9FAvt¬KQOʱѬm C^~M[ 2amN0R PƅQX+V pvGǘ,&z$#ߖiA8eJ26s¹RS͞o#Peu0{N<@iB&30(7 j8F. U Rt O @m~XZ8k%#nQ|9 ǗVyo~[N5.uSz]blA-ѯ:GjeeNXakR'Wl RΌX/Z&5,5+qeɚS$1Gc~;8 `ݹ @#f0HiSݸ_wbvs Uu[P5]%5̼O:S @ Q8PϮP(ʰljh멪%:ټorOÇ4D{%DL36XZVBS:-Ԟxӎ%SR#md@?Ņp_ 8%tvلSLeXNi]!vrUyoxSR5Y詂QٴEicOLБ]8FD ӄ)(S4ɈĪT;&HNiۀMuM@w6CA_x{G)5B ǜa=ϖW;8Z@&k[OH@uoyƔF]~"椞| ^#XV"R v҂9E7< [Ǎ*/IpbRQ^qڞq!bn#RcZNX ܕ8mȩSNF& #Qsb8U'Rc"nE*N5aq`ܝxXvq!JʆsJd"5-c HYwkE kJx+ &&)HH5s 瞚Eu{y)njk]9ߖ}[G=5jj^綞zkq\_󝍭njwǕ9m<֢[O5WsWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWѡs>e[\sz5qDŽGBlL) ^ˀ8'Jʺ ='*r P4iom{k@4.>1O ʃNPՀ-{ìrp+>dmߞׁØd*֢XU=g=5nS}yi\iaכbprd0 q&<𳋮[]\󒮧ǚ5+$g=^'ǝlm=i\mNb_(כ5οg |9 g2X Aj\Aoz떿;sGºpӱ_TV3ao%&%[9^2ZJ|:5A%/:l߈»C?{=X$4^<5Kn@F20 N6ڸQuPF }ZE@|?a%$-ğ9L1L 3][Dž>!ϭ0l-ߘΘa**O~%k:SDl0'7Fp(̙i4srV6ga #E,R囝n4#]nH -DSuXn ѷi5׏T1Ҧ朸= sKTq:oxTa[wmRbt-~ʔPhFj`IU)%vx29IL)bzD8c j,z)59S&6חe;+cN쀎'*\ YㆈJv<),ZV1A2kp8 )*P7t"y "P sH1£p 'oǻ6}Ykב_F[Ft8L*BUFdnqЋssMNM>mG-ox zLE`a}{^:cx<7q7-K}m5~0Oi8ͩ:yx:M?JӋf:7pO]4ɂ]W'ŇYʭrGRUmKSSoPvIb9Hϗ^E(A+xiFu2m_C~E_tڑ\㔯}G!S}?wOo9wNcӚ5۝EǙT q NO9='MFEC-Kow} trv禌PpbG {v !COO|$^4.!CaP䥭M+k9L3 `10aʇV*V(YkA=ڇ8˗hʉ1?PrZU#Սrb#rQaPGR^GmonF>Qe=%xJFpqRaz quZ ]d,(cZ TlGq Sqr~L|bG^&ux+4bxTZI}Ǔ*`V߷;Jܑq,;6@ZM,Iߨ7&=|Әʂpi۔{DF­pƸx6҆=l&2C@U 8 OUBG %ة>F7AVvgu)V_)6'DB6u6R)VIP a..U2e'Ab~> (ՇM5{! 6Sۙ*Xfa¿YJql`qXf8TJ KGJV 'SdTm}i~׎ꦴVo5?M-[g _M5M[߉8%C1pȢEV: y q?0U6Md&9q+ 0"-TQO偷SBʄ&YRgwoǒGiI<6VX[&na #⩤j^ǿǝpu<ުaؑl!M+a1P,^܉\꽸"SM=5 ޜuaA\PQ4**I0׎VG&('8,MP E{hFPs8IA$y➊WMrh]{[|not MIӈS@x|(]߼nt]O~RveMtNҖP/qsU(ȣ2 ?; }y5-/缩j/jl KOkZ$Oacr;1s( ertEb3NaFi+ ɸ\snjk}-qVӕbۭZMsFMoMu0u+f#S[NjrEq󕹪W}zzUsVsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsWsҢs.g[Z$o0qHn/mOGfYx/Ȍb%$Lc8mjt$pN,&8,l ;'n&b!t>XHW;x\f㌚xVqz3NV-<9|yٯ-ӗHJFmT1kZ6Z+apas wp+Q\t-؏vX㜚\sU1VY^A>9ZuwӾZ]G<{9WEyԞqU"ssUvW[?o+ rWEZ@xog=Z;չ_eцW\I;(|;sS^uI&{H怗V*OǍN$9<=[;Rc؍/kI5%t EAXqSAܧ-\}vC5 (w,u>TKp&VH 1慎$0-4iq8NO׍$]?}SƔݚ!FRHֳEB4Shv/ G9,br|-?A'r~4rO})| >h>?5|ۅ‚ ߈J.>*czXӍ9V-UCD25 cLE1KT\ i:H?_ 3w›NPEIF{a0l9}UM5KnӸ妫z+pהWDz\rW\|s8הOifE'Nvi~5P]>E|5i?p8VAZ]! L_m./q4hʵP>f]orkqmخ#HѥuR?{볅{H~院BkwPGV@lHPO=O.{89xiJvTX)N~Kf9ips? e'bϺSW T| o l__Ϻߣ\ԝMTr8sC!?7+g+=j:޹?ΰ8ح~kWϰW@{M{jH֭1PpشY˫gV=ޭ䈱XjYb A.lOJq+>t<@'xvbY{pO4X'۹zXHBXٌב,M0iejo{i$SN(GJj_h̟Lt 7$ <5K^LS7]>1 3@~%r&ybE5L{7uSyIB5 v:xs;PCO E r5{9kvTGܼ}Msi*$Hj m:;M_X3}K5j/OopGR WX*F]YrR}~4(`O%+j*YŻDnRu}, AJ\즁k+*ԳExWꢕZ.۩]hL"ԓR tYD[(02'ADž aF(:_M6KTVG]4>y* |H?p'i pvf IA {ry$DW4e<8$pW(*C2~~A0KgRq84i#1c1(Aqsfh5Ql}rlNϼ~%-ʳX{X%/J/;b6"*=r%FxjF2xU]0;Ǫ\$S6xBOֹyU)V8SBnpy+aC.?_ҩʦ7'@>q w?e}5ʣ5X}[BkG58 %ZmAL8ulF^9 j>kRVw} / ›ڶTF6<% 3-ykš^ZPHD.We'MYMd [1LxgTL0ge қnIi0!'aiVXVX؀Oks>w =P|Ù ÙoO/+#5}P6~S1pFm=z*'QS NG{u8M**'ݴRNsaQ^(&(I?G\.Y~xxh2 djג&">ƻ{"~8@F5m͂N&@ woi&)3XUs+ZMu3)ӷ&jEqgSk].qr+_/fx09ZofʅnkmZ"yMx)aʊ^WRmj~hӀWEs4!x}b6='dT=U~oM$ T,$9 OpENeGlNac.8>Y̘Kr8u8w݊!8:o}wb}m:]B|Կ,MoجsTo5s ^BRw s ?=r+?~[5VO/2.N|[{[b=ioM{U!Űo zkЯ >w1LGv~K"%\sSXwB=\Sk6D/ +:b=?RµLl-DLGHX`sb}A.IbvGqA0tqIoTOO RTV8R=.O2֢be͕ԭO Fs8tU;Ǧ$fE CQv0 1E'M&jCҘDQݍg!˴JM 7oaE]>XP3P6PV ~~cZ]*[~@aqH*zU>4fhX&7PA^h4Tijk`g5>xjz WOƜB<>tQ"CGxFJ6;OV67˺Ž1TisRۼq]%x\DQ3M̛Y+mSEOF/#hx,AtT+ĵk_5+ v:wiqatǃeTt&#F: Fn9m^]v) Z \{ȽhJu@ WK_o )Xi~ct~|<$ Em9+`. ~|LUJBMG%Hsګzk$ݾ<ުW-Ce0.[:Rr4ýM[ A5Iʐ̍4H7IW~qZ<֪ra|sqƞ*8l>`Jhm#}Q;iڱ1qiXXtJ"ߍmf+)eb_gj Y rƠɥTV~rh][Ml:b;6T}Jw=l*+$h~sHYPSV$s(EerV\9П=^5 R,9u{իMj̀iӑXXl9]yEqv5^9lblsSVs=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5s=5sԢǚmaΊ)<֫Hzku=s^q!YAҞZ`YՒڏpEwjvqco'X=yw4'%K`5}Ɵ.ȸd:\+ mLAn-kZ]T;ۿ8}\VۨHuݴ5[$˝wv:ϚWpTL֢+bn:Տ=Z}9ٻX[+{k$󢁵71^խǞT`֢kW㸒m~rT{</ߔ+kۙ~< kqrxSpKXU#)Ip A!.>x\S Rk2QIݭQ:E=5 :{@y}TMs|ygj+91N μo68RsRuvpSf [AmV#3&\ >t#ע;A55h7ayEvvVۜY s`֢F=^׫q~zkQ^$jkQX;)MnV<㴑qMz+k׫^_=5 缳n+<:l7U5FGLT=6?CX0e;*6>;|R})aZeފ\kEpӥB䍮>1ᦛ J4e[;HƂwMi^ª̴du;q_(ܨ$S'i6 bVJo.3$qnT bf V%;mw#w&ܙ؍\bZeA~ q%(0fJ"+S@%.,?>ErDIa Apx{wW'Q15):6<tYg#a{vb'**u~Y6UgÚYհ+ϘšbE2*xq8Rrlj|@I#E.aOyy/qʊޔ x%q]MxJjYCܞIjM;):@YFqu6:,FgY$_8L6#Yg@b\xQB%H͸R E$Țiu+'_1Hjl<1K%4^:c^42:{]8I*"1e Ki xq `) .A@`3t߷91N6A;+H#u< +`Ӆ j1FLrO~54_w$RNs#hIhp: cjIƣ^r'6/WP8 6~?c"H䴯 fԮ;$ * Oe0Cj3{P[Byl[s:趷{/y9@,|y]Uh7py½<ުW953Vo=Mj&s!+5`+b~s54V`榽s9W>r9W}Mzszj½s-zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zl׫>{`禽^=5Ϸ9W}Mzszko=s^\y탞zբsw[V=^o=^obۛ֎ڲ~0`X,0=iEpI"1"*d*8={mpl/sonH͹$+siꖲ:0yj"T[@u`XwM B9aU55ŏ87W{0V/ݹp"W-U@.}ׯL mˊ@{s`9ZXn sQ[KrrOnhUx[ǜUk<9@#5jy-{yz-ۍyJqcǖWwmm|ySla\X4WyQW5J8am{jk):_s5c~e-ܤus{yw}/GZp;P@ c2F rz>rD"9Rkbf2,wcV[nPcV\hĮ\ZQkrz[M9.禽]i+ǜAѭ\I䄖e oE:kXiKwk.#S U,KMBS{X r8mGmVExVCpu$}sGA@s*AwGk #qaG &Yt\MdnV8*oM{= ?w=rz+CjbԒ+{=Jԉ:86pT#YYaK]on9Bø`}RFHa 8)37X-Jx#t¥>N=&CMo"[tT/Uֽ ݅wO9.tWV}p؛DM\9va?=%t:+T?>um{J~u=*͔kju=U~G? iN~I]5'!':ʓ˜CkߟOkG\>\ić=^访L p7U_e8 қN:__;qE$9uu{rڙO(uuo访?O?׉,m\Zc+,?w8^'7t+j?^y !{x5S^E79皟݁?#/& \F8S{cۖ^:MW#}Ý W#9äWg-B-F0ɞ\"7s\~\j1'kPm#tQ&9X-n |mg0IA4= STF&v@O*G4MP M*$A)? @PWy]<7QK-UIQ_SۇT8(J'iQcؕlcptC6~6Ӊ8, P:YV柳 yZ%}4`]_V<$yF4)$*\(4~y2RC@Sol.0ӲGU>:>ݛu#YREda,U?CgS˸&AP`Q M8 c 1l(%p*è&ë|)ѓ}.~Dr;I\K)^lAN2OWJՃl=ۋ\ *RL30lG}=Qh)"]B85b=)<` GW1Mr{8ҀdgRȁ5&$o5R?,,5>*T|AtL+I< !qN4Ba*Ha `$lm`}|J`iIEFG#/'ǵǂE4Q&Mwh`+jB/nZ;iF+Jfc`8;Qɿ~`$8UtyB?t2Ѐk5[n*x;o*nkL5Uc +.Dpk#u4S*M+|Qw?]'m*<P;i]x KZq4 MJi{rT (SÕ I0ȶk~\I]yッߎUv2dpbm߂~N¡tVBSRBVw$DQZ2mۅ k2& ÿC%R)(VHx1/V^.YI 0Bu3`5j}˥n76sPXFI~O]:W~nd\7 ^ǕWW 7]5V!= PQֻuWnPBi͇U\Miыs­p-/ݣ55f-Eʩau hBvEʟ7+GUxV{[ēd=+ݣ,K}\5uؿP< 0s"`UҎͭ?x?ƌ7+]um(al/mĝDH~ )Du iY?,H%mǗqTm࣠:IcOR ~S1T6'-tiN(\ƣ䘝b>ͼOy*ʲ ;QYiqX]mpM7UQ ww$ne{VE q*(nu<7\zn5'NKXm{a禽o;oMl Ϸjj^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o7I1VӿQʼ,QU??WƾY_5b_uzs=W=^szs=W=^rO (򎳀| HOV??\oqOa|aK51[\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^УXH8WPAڡc{yZq޼z^޼UUNv~qf^Gp G6i!UMmr=S' ["B۱$MLeg#${Y)CE //~X9gq˸ݤ*#O*ͥ b]n`%SM4nks4ie>i{5~)c,wXnÆM޶-r|қê NcLe#/K[ Rɸa Q4V`y4©%8;ߛS\_=^xVx[Q~ag

ӮYbaQ9FPNV"K!  ,($"$M ,;榓ĉb.E>)q6Nɤ"aD)P6z|rb$}ڡar}|DrΞVz'B;حՍ}74V=ȳUE:N4:)CPMiIYW%TGIM%@ZjVG>` v#[51TPjS,D0eI"T!'N>u:QGAD,34IUN5$[xDlt?ڈ'1x#FZ$#0ֿ~τ8 m ۙg~)4N5[[5mTފ&0=pn9TՐ2ʌ.G!P 4E&-*᰹?w*ٮbx2BE":r N$ qwݻ԰0%-`mnyj´]*>sƌj"OqߋXRR7Ҟ52ZtDn=G8Nƺ8x(}VSlGCZ"WOn?aS5k O&OԺ-oɒ=@"t4 ]51D^,j;r|ɱWKvaQVη$ߜ il~Tkǜ "7޺։ lE2T#FI(WuSb'>kH~YkV1 'NH.}j)-s4nǞ@5D$yH& ӆ(x$WEӎ^tȑP0SG"њ|46Rit;굹-1쥋jB~*m!.~jƞ |i`l3_*0Mas.Df4S+^w }? Lz5:e1b|-Rn«E}U6翙zc,JO^jb%OOr, x`dEe#f4MIhaQJR_ m͊\WӔxQE2fd j#d?#zT RJvI10aOok-r$+5阃{v_4ؐt5`r4F6 BsZmnNW-UVǞzηm{ezɨR+W{:J@" adJHUƈtl~<:`xѧ@&sEuՈk Kon2E<0 Òcƈ,\ʌ vKxG2XNqq"NH+ǽ=[5]5 /{MȣK 9 fxǓ)]ݽaJҚ$0tCH*ryGean6Ԫ u'P}a/ q]+lh'5>Zq{[pR*qe<~|zцpzict{>ň$P3AHTnb}tqU"<[]^1pīQKLw,G}/i)( -%2FgIUۛ 5.FHg #3GASVu`s9p+53]yq{e%m>ji'S?ˢnEBuSJ:kb{M\z& {ߑ֠1T aǒB;qfb>aj`/%wq+O֝U"ѵ]BVĴ6Mχ w)^(<^ZÜS M9j_sDl m6Uu_(dQFajѶCw)܁5s̥cޝKղL8K*`G6֌D, :nUJӎ #~MQ*9ucfnKG0) ) -w40MtF "ڹ\<2% \oo2j~Ýݹl^G!|؛+bBAoQ?呟RWbXn)-3-m:qMaª6h9WXaǪO%u6z?JR4..Vӝ%i'օ_گJIfƦ=GmIoY!e܇=Cqa(zzÞE{ssz =^rjU8_eLj9gQo?x3) Q7Q3\Gʣ+d~&w%S抺IZDXZUXcn )2N&m2u'QGjݮZAUiVGtIQƘʴc}qAI՜F(K$STN&I8}6[ cC_̺mX*)Wѕ?z_VE}#5hۙ*}M~הUƟwWMbp̔ zn>+޼_)ڀ=X㎷e2PG}7Ukx'2cK%5dɥq1E]O 4f?Kb|5Ҡ0;xwwa\[_p"i:2+|/:kcST{9ŕ/e6 h\ڞuW׼ 8d-3UÊ7"IphOnPm˼ GÔ Py-q]MΖdgX} Pv-r=v1Nt[_^JRp["|9SV{x q2)Q%$gT;Ѡu HS="hb ԀmNWNqDBl ];Rdk܋,h3Tq N>ML5F49,ap$1g2sQ1KisHaQ wm)1`Y&4DK/3Ӹ!e~SAiXTi=gN4osѼ+ZN8 f)6JutTc3cՃ` E1Ƴ|Ȉ!,950`t;"5tkL𦨀0+VћOg$*uSƵSkC>[nkZkqߜC$'5^ƺv9aeEXA\[}\fI-ݽH}9MYoLSXJ0>-}ǹVki{s*S~Rk`Wf+viȬ;<5jkۜ5Z-z+۝UonwE{{syW 4W۞VonrUך^緕E{{syW; UonwE{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW68:(ޮwoaZOqyJ}MXӸ_~ (q{{Wz^{{Wz^ DC{zoAQXB?7k?َ]ޱ БpKTO)?o9_fQD{syW=E{{syW=E{{syW=E{{syW?ӤטH.#.ETSk[njMn+0Z1{ű"ر*^qے=m& T1ܸH 3 r7 X\ w }=\%pw+ځf}VX˜d%[vi% zbIYoGh7Nj>դR+ jvJk:x,SQ%Lo`'HbDƅEĽpZ,xMc!+O 2JDoz>ي@37$ sTڞxr/`/h҃zzyW=s綎z^޼Wמ9{zG{zG=^o^{hmzyY>5b>[}~J0FP{6m\Rv$Ȁ۶-YZ%A?,Ӂ t+(X)G#) v.tz^&jj#)(@d? ה(#4ϔ>RTaU+B#cw_dG~4npM6}S$g=?o=BCMa F’[.uPl2N`{ wQ--^n_~zX̞WԌfFX"3k]FuzXs]&二_dQ";7c)e칂'fEju]+okk >9E#VRR8Q;ZXGvG̔(yNq:.s/u|Ɵ1a HSٸ[O㷋!īa֐JqZ$;QկCx7a^Zss^^a)ynIג.;[OX:eE ,n2ub{k١e1H*)Q ;ۉ*ܱ%LhR>}؝{v1DZ  ? }oGo̘}AIk.6woVZtj“: 5&W Zb/[t OKg 2iblFNǿ MSIvUR>Ċ)0I Qd^)<Gi-*H{[JRR?&#//Lrm>Y^S=LLeD)!Ío6"ˊ1}PX*Id`3SRQWKE+B#Ԟ%GU)x#tÊLQAalmG 2Z0M8TX]|X/`ў)#c}܉=<G2C,j{2E΄(}t0D*㶟t >yَ)=^k"-~< 2ygTp:Q;i/$֕/Jb sN1жOG{L,X|9;kc^m?֟ nz2Ob,A#*bRP,<0ܝbl*mRɒꓩ31v?苲Lp: )­FRB@A3t/V _(xLg>}f綏g=5o^{hs^綏g=5o^{hs^綏g=5o^{hs^綏g=5o^Ԥ(ک9k EYtanwa iTSKŰ$,HqEM:PRoBmpIt׉R***2XrxWяaԸ=ZFB~x“HZK)WEN*x 0QЎ ^KmDe <r jFc>8Ґ<31Jh.?.@ O(zÞE{^9WzzÞE{^VXsըsnXsusE &*U$'mrTw;P}s+8Q8EyZڝiĄ+̂5\ii|zJI eeAM O-[ u\_iDc~+U.ꊳx,#nnOT,H 6W0۠?.H 4f~Ĉ)|.kjwFjo]mkLƠlcA;' SЉBfѺ/K/2 ѯQ_W=(禰OAڂTgoPbFQ >R>4rkGrW^:RfKbt"&p>E<*}K|DhṢҧNY܇Z*us9Dp')gG\"̔"e~k8CT7a"fO7HkrW*} Q u1_gqy%0uWC)n ۅ&rlƤM6 ҝS:ik j_BHTѴu$*ȥLL <-n=3LWP|x#k&1M@{mE٧Ec~`Mj+׹ב׿d|,&h'^ T&&UM)H'Jߔ0e/Q[S[BaB~ܽaiOOX{Q=⸝ JWY"C#YHe#BxZ`AFi!`88\I QЕeabЂb9ÔpQ^sPTZ )dÆf(DƋnmI)3;ᘳ4[2!Lk4SY 2ׁfnj.#vR)8ʥYd$oxVp̅fW`_]{2Sxq,#;H˜>1SV/F8Wmzi:|qwbQ3\H" Rh}ŏ; mVk󒪃5qX_vuǷ3ujAǝjkQ]י6Tq 9յ&;kUĎtTzkq^c5j;zY:z9LUOS60}zq_0$UK-'tO=P^⪷2H2UT؅$u$uWFS+G"[QJ jTBà)&AQA4KK;:xثlA2H ʊ 7,2ÄwxGxLx*n2)1K XjQj5V7gf9fA#GkȸkHR8M]V:8JbT7cB0aL1TSSSb;|xte!!Gn*&U2jo=ŅS4-ݏN/A螳/4q *J: xq*Z]Bb`zic/:ZT&$:|* eF 8 ,ī U1H Pk_(% *맔X#B9&+e?YxҜ+2iԶ V g _, G)5b+"50M<{PVS0F Ԁavʛ7ט1 FX(!=6U=XVӎx:zJY l?F1<۔q J HiODk= 1'5di*Ң%E*<eH'>S&5KI-_F74IO+Q,l/mA2ԗRF} SJeD\ۂ<5uFeX[W@P+TǾMB*|ǙECH{/"qrLJJ|OU3ыY'@ "}Ed?!Edcb5Пx%nzi?!qم(1)ᨻPNFABI41IRq@Б*x徃E"-݀ӚXOհ{xfdלNt4|lj]G `QQQ8ӨPKJd1}ƗufJ,@U嶑16wzLJ1sۓȻixOQ6rʇ:wS$IH]~cRex#efv[ۧ4i%f$UXibAPiIFf]ksqvw"k A7vX|:)XwEky @Z[Oz)=5>Ň CUl&gO,xrWo9nV]s"MZi{z+,xs[XsMZ+95[s(AnVk^g55s{g55xsWMz+榜sSZ"̛WMz+ sSVg=5hsWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽{`s^={9E{=עlzk^g=5sWMz+禽Ԍ@Is,o^+V=t/qw3z^{{Wz^{{W?y̸.s?d]u}>e_W`GSS{9 5ؘ=lzk^g=5sWMz+禽{`s^={9E{դ/snrmu7em3iߘ'z\.8%e>KlW3cfhYZaeŃm88oi8pqmLmKjQ4{uߩR/ິ),AHMM;p\02';ijQeR>ꤎ%-1*bN?Yr쭭@m01;kksU5 {:: ~ׇ/[Rb:hY:U3Ok"J@'xz,LHlM}|]/`bQJeʑ*V "S~ڍ{k\miz(Db{]cV/1Z)n!qE\Z^T_?۸c$ AYm;iEFdJ(u~Ɗ}rmh[j.T)Үjt8Lw!''n)Ƈk=5٬x?#ɒAG:/QqU A)rLP}S5!3brrddv~ϷLG =r$S;xLGtpJ~7KbE/%[e4%e$S0_SBϽ=G}# ]V&`]=5 h?n?e%S9,nkC> '{UHO7ঙU"CAms_SnY+)cr }Z_s8AȢfݺ{9oi.{`禽^% s ;r$XsMjs=5;1~jk7[75-Mzy׮9=ymlH\[c{/8035$q+-kk~%q W)Sn)?iRΚkk}|d|T 򭸛=~4J|*9i6 Ox:_it.—Ļ=Y-~U!V>7]kŕ'UP"2Gږ2KɁ3gGd#Ld7px#'B_+㈰PѺKkpf۟p4UeFNc0#_-WS)kmf<_´4I@2W\ZxpU/_xxe[̯{]C6U [^`dc MY{c #0@upaͰwpqVkttkf0US"Q?:\y^Q:KN j9ujRO')UaKSibxph›A~jkbƜMj42h5qkPp"M$zF r& 8*I 6}‪v}+:oXk\Uv! ^a-@OPLl`.R)1jH]yS@yr~qMT ZKߕv31}'NCi6 5$BH<4X\yz$x\cphm#uiՁ<:]]6uaF:^4N`F!%HQ*y4$wvaqɸߢLIgqzZ\KIX}>/6Z?&-FВU˸%(4#o+V{Yq`#.AYFL9׼@s'wz2 |wIG~o#a !:b2Wmm9t ;ʮZ@x4xd'ju (BƝWx~%le7*p"~UJE7n;,M"DL"o}y{KsW^_55honvoneTI,<b,ÜsSW9<⽽fsV ǹ-sl榽]oneXn+ۜjkU榶{{sM^+۞E{{s_=5nnrM^ iK׈{ۜVj^Mz+۝^SV缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{s_=5on{禽y|ע/W=^缾zk^Mz+۞E{{pu-ΡTPTK.HD4 XxM[v)6%@V=keﻞݩ-ꠄQ2~<6Ũ9qU2ث0#N,LʿginjVo*\Ɨ_ _!s{W<+f¯,/" _ffU6?r SGEIrx1C/@'JQs?4#u&i "u>Q[1>#MOiN"SAHHŏ1#o1vqq3K: vv7=aU؅ָ0=A?~Dd5'V”a44_̐rM8IvԵ(˥s^W" [<C)Ko>OVN@7ӂKwijYP;w1Z|:rBM"#_nˋKYK4jRvw`ܞ[Z DѳP:U0Nzv}LfHLFyBH}U\ V쬚Mq%I WdiZZu82![Q6VToxmܪ%r#E8@F3;:z+1JxtK|xS*ZEfVºIs^͔M۶T0(}x(d{[Eh$ׁ,?B)Hf"-J{SǴ[. ɥ X6ۍ9ÿ3&r+k?lw禷^ܽn( {GnuЎ.aF)Uu?fX9:G\ܫ3D!!}劎5H eY$g$aUo^v=[yh"2Sm*)2+jHP\cCbÅ&FM„kԲ:4~WaD}7vGݍhNA.XfSbABE(47 [rAdZ:߷8-5@A/w禷XYRj¸[Rk^9ڣjO4MX [4SWps p9em’,Ex5')Mn+Av `;ѭ+vUEcXe o~Ri+۝w:sZ"ע\[Sζnn^"z[6Ӽ{J|:E׳,.WT~BAūCk#$ҏ)S]07Yj@cOu#ª45r)UPΜūNbc)h?t| ʘd'kKPGB{tt16[ЮWFm`u偪Y"ooXeXo#<_ ӈ:Oi G 0amy+&u+s$%TL'ƊX&Q~^x[OgBoL1ΌՖ)~5΍s'n$)#vF`7ؕ32b,}4&qP? :ECs7[Ʀ(LQ.m l*kBK˜osZ5_AMT BO-5Hׅ7ּ?.r˸Ji_o9jCO@$?z*F/H1 E> Z 9;to*&{r͟5Q},[rJskU{9WRQ^"v@He6ǜֆhmM'拄$U`]w&7 6dpn)Ap5(D趙G0Z $97t說UDt8΄lbQ@ e_R~̹ QvdA#ղ*>U36߹7v x, N> v'mmDa8l!\%`nw*v"&Fӭ$VlmY}HRx@ q0\$a#1I⧍ffSmJV%bK%Bd#5+ QͻArM25ME o~٪M VҁB?Mb[9k<#εhܨWxSo8/=k(|.ik'8RINpDŽ[)2"$ә ~i?XJUF3ӰAk1?轉p/լEX*;Y $u|5^_[4?ӣ.f=-!gFAØxe DK=ȣfd?(~vմeeJ3uvd'H*iB= R+[ F}m$)Djl<׫MzwP'"c?R~,? <"rdqɏg %VR̓ۡ_Xb@}Z~"<jl ?ܸ,Wbdj # Qcr 0Bl-+A>.#8Tmo 7~ֽsԮe3;Le/y~N\H<UZ{&`Ȏ'x!a!FYJYWnHRWu,giOV z"_y rݻsUڋ+HoGxJj1D6#:׾%N'ׯ,i՟seT=^sٯ >syY+rU7榴kUp?P"W=M~a%'΃wJ\:eao5NmyخÞj\36M\V25y)[vv8Ux{s^ #55m~t@suZ/}y[oMX s>F?4{~n+\s()N ̪=wy]FzsUjƗz]nz@x|tߘ#DrR5θT]JCm4cOnJ:1GJc܏23S*EJ_9Rt灭p1l[=GDv1 ]t;ߕ rņ¶Rk3~jG/3ֽTIR'YۀǚҝS:u sR 禑5t\ P\P.p8ab;\e@#O$7{щ^ܸDmm -[Um-q'_F@&$P 9Jqk~Z]W&'f1|J}(_b?dFcҁ~yfym-it`~_ >rXZ'IR[$߷F~J_wO ,HK*>tׂS? $Tk's^%%X05WD,yUT+ mz)DaҠ[h36!Jw-gpD :Ż"dz麧G媯,.\O%&W@tRX54H 39UeK}8ʹUzvgamJiEpTo FqFXFhݔe6`Nc‹R4b 34`܂.}RcX#0zUZvS˝a >G 38qiM=[z^G6UYåPfMN-rx:|L!zJmwc7+y_#$Ry>lRZ$-G $5Rfxښ`E}OV'NIxmLjПi~U({%HAN+*GyS*|[JbFVp7䎦PIt#Q^Z m rQ <}>-û^?Թ7m[:dy`v6_2CNۭDZD `p=`vDSo8.թ 0vt1tk fDz". HSGp;kG 'Ab<}ZUeΝ);DKiqc5TnG[)#ґ(P>:\:xK -#]Eac+zf/o6R؂Hn/=Y2R~|;Om<#"@)}6y8Kkf,ܞ [π5Y:՞ֱ1zevs#w~'aYb| G(+NHU{ IJ|mG/JPD]LmܗnUÉJ|ᘕ,C|| ~|8M mG!I'4N;xPGT)˩2aqMqf4goq F,]>qusͫ pm3җ-a-rI j^Äo'QqJ TFH/*ÙGjʂҘ FYmACh2<**atJXx1TzU acrIJ㷼>6(V?,U6V_-:Ki K,5:}A=^; ofJy vTh;X>@v* ';c=&y]V&L6NE8~ Uu=xƄ <4[P8[^5ĉ#+)e\Oz*X5-m;qL Yf/3Q8|`Әg/qmv{z%*cI ͨRL({keYA'c7? nzN,?:LiCX8/T }c}~A/8:}9ƩEH4_}`0?aD("jX\bͩ,AI++Zq/-B8EJr[`lAATa}bT< 8e OU~r*|?5M5hzMuZ*sըp+tNp64StTNȐ%'쨱k@גn*OBzNvTI@ NxҮm&:Pkj٩ؚ(_N{r3YzD>|R T+/m/bO<̛)OH z{6WRbA!>{NQh``i3-#vq\Fz?t- I+2IJYj-'p~1೥E\"HeCut{2G1l4!I0AFr* :j0S!WF.!t7R[%2,n` G"g~'Ԟ$vi:+dbٸ2 FB5H^7d8`v74Ms"m[N:.I)Xf)㧌 m^ 4PiF5VP<:e {WǸ#N]ݶRu$%\h[oTEIut;)!zo3m3L Id(Wu|n>^NY W>m=3yZfn68+`n{~MCf#O<+"b.5Zĥ=#"8m=DZlS}0_ Q}9\YתA[|Ri"r,KeM|IPdjaN?.2Tz<3f:]BT:?ҋ-^VGLS >-KJ-"lS,fQ$Pj"FHj&oN팠F Rz'<oi#6q`_ aRnb~nu*Gbu>6_!ʙ"mx4cY+xiehr*+]tOwheҢAa#A EjHH,2A,`6c1?H!}1K:C'QL PO( O0l.ntEfۣnU V cd;e;p!$d3GrZr lBO7mm͹ ^3~m o&TH2k8&= {qFMYq}=?Lg;(g|=u'$S"Zȫ_VlJxPŸQb5ufy$^ߓZJ@{*SZI'm RC$}~z'Okb2`̭vB<ofR)"|R>QwYbR18Uä_3ӼeYbP?렰ad߁gKu-RSٔfG B=k'2TˢAGhʱo1i/4e*t6%8 Rl˚x2FeuV,J욞Hْ6e67xm^B ެԝ*#EcIFpiʀK1aX1 kbxfO]Ur\ط[ U7 IK0F#jz@4H8<I]#CBRhdF6e7:x #z\wɫ&mt`X6#pp BXFe}VK0Ab6K\Rl67:4r-Ⱥq<EzgiiWUp˓?,UConbN"7\1~?mqap粵EkQӚZS 1 ;; ԭ#Iufn^7V=&f'Z0tyDJ/`QÌN6ZfY2'6B&@~{+w7t4י'bGIEfPu G+L' Qڋس~ʪ'Eat$э$[FGSIRGh6ۣ݅KnPJ)MQ2},Ϻ"y6'ާz$w2\6p{p-l(W3+(UeR +O,!8Ўi)Eu3yK; $(X?9q}#՜p oOLabѵARau9evHaX*E,q`T6$<Хn, G$x8o[ Q?d:y~t+sϑ~Us|0̞恵XI߿W^hz;/䌣Wf!M(z X161<|( ONI蜏+jݐ.gD'箩yBj8SPmquS)]D<02VZ|p?'7f"egZP6V|ǯrl:_m*cCy),.VROQl>D͎e<)ڛXZpyO˓*a%>=MX΋p>bW[/N4٥j3jSMAiA5/{ۅ7yOC)ɓp妏%<(iBu[^He{So3TEbQ5ѯ빷JqSxS/[i=\ ftsvQZJ;GI #ݹEH$.U tQdv$ Dz@O?yխSU08/Q{~Gd6ݲtLd RW9.9rHP"x4$嬍v[²IGrNoE΢+ yΜjoӫ |/k,G)﮾z#$,Z9 W7knfn^]wjÈ*RЕRH6N۶jH`1 z:s>bO 8#MUOyeໞ=o͔M0$xmi3`3ȋ`9hab)P\PBF v$l`@0edZ!oIITv}>.5ZYZ`I*$*зskr+c8u#>3/UV(>  (̧a|57dOLz Fʙo,ӭ6C *coIGA>c` ,؋`nBڒLRFԓiIo;F(Fcd }ij mio/v7IԋEdOÌΖaUOE(0@IP{nXTn'j1.z}ʧ2! }h- ђ?RGÆik/Vu&1$ vT1zT=bSp*\NKr{ #ol_~jUY0pEHh.~ À!Z }==fQ=ugM|+-QRIgGEo3~.uX~Bb(J[m"=sȣ2[մ۶l)q$)_q3\8T#d$ JP#I +PeBR4;ݏve+4Ӑ3\O`9`VTHE5qcs1.I:9RޡvcxFQ蔢h6b4?.HAcvfxq 1'`go7hN-e#үg:8tᣋ Z;;4vo{EηTkdbن(pOs!{X?9(޺x?:14X\VA1BU8twHikq\To"C47e#]%-^ A3JڽN4>ԜQ*pL悋G%Dߖ?jt>U-.ss`Cwd'Mu^`;1k#> tKjqje#X{7{^r~=ߵ Jc= YP$v8q<(t[5Y$R-X6Džӿ,z ͙xW4mCCNJR$@K'[`y%66^ޝEzJQ$#i1QoۉCj $e^&v4'uKXt.ӚL8P!.@]lrl8Szë[%VtR4q6X^ܙ2MͲR!kⵀL}1&|osYB8!db@5~dlL:Tn@OE7TknC][OR+ixErT4=$8hTX^TVm*ݹa>b칚 1,D*/5,vL4$0bvAq|Ush R!++ Mw^MڊQ Q 'vm bOB\S>ik镤xb]2@jܐEl<) 9l<ӑ^y퇞W{a禽bt<ۚTDֈ{9m<֢󽇞Wry"=5oḆ灤i\*|cS-I!k~!DAq4 DrwďT)a$Qv˴+(Y(#:(7@ O>wzGN?gp=pSAh][E{nb$p\1)8 ?M ,R#pqq~sc1 $kܐ69QUZ|r [rLV mWPߙݕ/VoXS7+*Oq3/ xFuō>xg&M հ 5ʮʶc&{'eZ֢:2y=beq߼Q=mVGlYJBđ>v|hcjΏlWOՏyߤyW7aGOMhʞ$Cx >7nj:z`'&pꝇV2VoP@HJ#9_ V,<i=y_5U8mlujhO)*#&ہԅ'@#58iE*Af!Js92h"_+3W+4;sd$y6y5P=7ʐۢ )%$Uߜ0X0nV`6AG&<>Zdp;*HiAtI0=j=R@BDPRfv IdgӈeIISx":|$Z@\=qFcg뗨1$.͹#1ԕ#goO|ȣŭ%k{w{Cpyx/}(w ?>=i,[lAE#A[_xc4Su=ǘRB4]i =2>2a Y"%p.uFOޞ? ZHs+r A[qze5WXb5t//xag?OQI\*Z.E5eM,jJbFW0w *})D|F ]] 6*;TڨFwq3nYJN4IՓW$mwc2bV8g:h瑭Æ֬;IHMөgV}RKcˠrh>@`b5ؾs̏W=&(g!Q@>FEZF @ Iħ\]*Q 78GAM$]Osb7HLp8e]A+wv걃Gnnytl*0O:OIaYde-+%q'tn4Kswsv";R|o$xp] z^CAGaEG )!b4I$ı1VSpAU?Sb;<9ۯ+3'>IFVbtfӖWVc݅V?4> gr~Mb dS%G]IEV!ALc.n5y2<8zOyƩ Ixb~ }\)Yih1'|k$?P? ,@kΛW2jѹ 9O]Zko0aK)vJ|6 *_cmfmX<8UeVBD'm(eo.aPO9 l+KW"Ļm=n穱zX3TT#$e]Gsve OYĞùZKq[:ɀP72n\J*{CGA $@Yݭu$ym9x'D0Jz(֢UF`걃GSss37j*0|(zOIaY{Q%*ۍ|ZU,c'0v^XӆG&W.9>[U|2C0:A[|ݔaRjH3Ƃrv)AGkSna(GxB1bbe~ x+Yͤeh:TzpFk%FMw BƤ` qGګ:eO绋~$i2ϕIȕ\Q-8'U%GdV?|.K H!^i}AҥTg2%NAG^r=a̔!IO*@Ʊ9{?/1hVU/+t"ZAB~|4е|MXnE'8l-tΐ>}| ri%urHE:؛Ac o~9`E*W: O]_sp% S6S]I%\(SU}F [}<+w'5Ƅ}C4saιlVVXUSk @8įHzsU'E_ _Ngy-Č:Tvzq=@>I,G#oE<Nsr(w[$HN#hszG\&/$ $yb~'WWFKݺq㸮 X+𪗂e7܌E:rizC f_>FԘ }KۙέÇ:GQ+ 7&9-lbWAaG3]ZZO:ۀ`=5LJDj ]Ӻ iԟ<@o 9\e7IWg[?ƩpsʵQCR}}Z0/iE)d?\c"PAlAN T~=4Л'HtR؍t I'vSU wE8YU a.51frJl#4-Ʉ2uG{:&M QUGp|OaiU1fX[)K~Ți{{lGK&eɻ>ңUi{?H*G >/t1B:*~[n3j&0 SYJ=OBX 66 usv6pOP"wCv䆑i'bAuiP7Dp_QWHײre9);vqyʼnvFjiv ܝ8Y=*f׬Q u@|jD} rX 1{:ԧX(#O1hV famE SjP ^#PGy~9k1UqKX?RwZm/3s†OPWQHK-(*9,XgMtl::o-~sκ\O}rU?y6|̒:RB&r#:;K(*zQ%of}Vԟz+w-:6GZQa+S'r06EV$ht>7 !čyҝV{ }N@5g=v -;wQu9TUfp7J*U Ł缊\HUb@&q:N~.tFؙ H`H4Υ (pk,%!mK \~nzxn]b lPRXI'ǘDsn5xSMX}zєW=WašXҾ IX"M #!ʩ `AI&tTW (JIdI"8፻ڳdAi& 6 `03<13=5cԼPFTfCy7 ѳXuѶj+zXq#5 K2P\7^et:In=̛\h^ 1,@lC(q _X^s$VǷ W:s玐 C:>/quӘf AT ^/yB`+=Cp6;,Je*~-(/ R1E+) M2O:5]~FLJ!JJ~U| 5?ά2⭁emFGM<6Up;)l""$TDU@9Uˋ2I;I8]Ra۠6 HSU8dfܳ1'<&>rb^X@=&wX$,?O'NsZu$G I@#֠Ѳwi@*!$yI҇My |N'R|jdFl}| ½DxyŊAYK "N^dgh6XqAB`Qs3Bx,-')PQoK*{=LkOO (~TuE[MtI( *&[7 @:QwMSnbifSfZH殝`9}W. K1k;?ҀOQk{HMm0z6$Qϒ"l^0Fw?=%tu1Qj+v 6U$klyGwe:Q<:UcR' luOvԸЙ8޵"Nea6WXO\-KE=_Ke|* .CCGN6 ".]ꊔvdS]nz O+dqIޢyMI'Z=א; y 緹"^Kpx%sr1#Rx)s@ZOCwąZT>`0['´*GR~DUO0DԵAȿlՐ3]6{FtPQme;' $}\efr;P' O[v3vDǦʩ<˃I3 v1Q,7b'[Nn1SBR^0}kTG3'G?OI[3ⰏޥF]svb~mf#@X㦜#>:GҜOE/WU[1mI<8tZ* b5x쁅t$,+\xI:G@6ƫ#/B۠9c>u ɽͳ羍eVJ>EoԞrx]|)%j2qԝݼ9/+&OBQu.g[ |#># R*[z[Ez@sUp+;=[q@4j^^󝹪r+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+zz+Ҡl?a 7&9'ZD]$Np¶qkHmMo8Kˀ4@Sհw ?YA=_e JOƒ5#oe[58R mdLfTw Z%#FNxL:)WݵmćR"}Uԃc^LJYW`q҉3Q$0=DĻ\ -s7O&x YLlo7C! *߽@ pͅi oHQ.PFpŖa6UڧgRmd'E^ݿG&&W(?W\CƘ*r5ױaN̂觱6yʐ'+1jS]UNG<¥ Ɲ<>?^s!u8܏i?xOyw h}ΐu6=ʎHƱu as??!|U4!'cK`-+O`}=Xl Oq\bU^q?0N2?΋s1ySW{IqvJK +C)ht?μ=;aVO UIX7ݬPF)'>tKjmKWx}mu-Er4I¬5ō`tuMlj5E+mQ`7F2wwժͳ$V1xO 2L?psuG1y嶿64V]sT]M W_/QhDTɹ$dM>Oʣl}ի= jse m&Õم0;yo2qH*c+(V@4$?Z3}8APP;Xh-bk0BBpLYF2>7dVd7BGySXa\HB/T1L%B1 jw3c̢f(q^p&ol.2A^:T،gW0٢6 SJ;ܦ* p1 ETu8JN 6҂AQ*Ȭ"ǖe*kb0]|4K?cYH[9oP~Kw?W駼1y0A*nƶ* 9"KM  q^oPѨFz&!nZ}>O03N$Vi /xb",ag0eB-ybMi@$2U~~:WUhzL`* .}pz +5 im$zOQi@|T&t0L?ovWW0Rf*HZ7"J B{ us".JiDXirlKRdhcdX63i:fBX8?A&QS_+co(fϚ*G^+fĚ Ki%(%+}HFp@χ-sQ;~y%#OT(4Z9F[c?Q'jYFJI&ָP Z倄hnv fdr6`LyR*h*!ODb2:ۆRιw;bXYEI= $D 2 ,~s}omZP$ **cܫ+kj@'RchS/ŇVQOiX]`|eLvZDǛaUnV< ^KºB*hUWYOUv763^Z7?9ER\ʨaT|>xb? s$zkg=#'-zIG9 t,jhsܴt]\z aMCZ"9mr''-ܭ DP6!)\z(CNJ|WTѰ7N[ؽlP@o#A?|_*t~7F#k]1h\ w^^` ^3]UH˙lOƂ?^kW–=;?-C+SHEO9krOJ(&m s] "'sn*{)w<g ,oJJ} ,w̭Ji\OÛEo(s$1$ܓܞttW9 MYzPEYM8vMu,G {`*(EH=8I ؟L){B[HHxN mWʁyzkei&v"v7?e[zckHnDTt>+TިZJm!\=G$Ι1V̺=VoT[1LC YMԘ[\F?2w [;q&.s=ۋ[Հ_OuJu5E,z>Ru_-I8i FeU n{pxsk5ټzQmPi`ff7{)E.wN*ШDb")&ϒ\=JFJYF*c,PI6T8dx45H?`N,gk,*IڒI]}}G)=#)sy8$WLvQD?te_W: .*_c/͌@!t0QU_‘t'/ʔϸ?o說4 =[QiQHO-(*9;,XgMtl:osʺWXvK!hd{ *t)UqCԭU͑L.M}1O@uV[X#8Q6>lf?*_wV "ULv:+8SUF< VN1o߽bK3 lz9y]CW]: 1 J(cM*TQ[˰H[x ŗդ`}5TwJ˞m2NhG3Ou# ,bc1\`ݯ( ( k3U2 A{]d9az;$8MxmBiV[X-f 1U,,}D(O͕j[͙jqSC_=Շ)сAsneD)&uFєH<p\G/bิf*g(}{A5M,+F'*G)Rie# ([Xrd,]`$AHxϐo<|n(adP+b@D?+,#M%|zʵ6!0aUUh(/2HU&,ZN R=AGܓX4(ll)JJR=g=D4_K)e`$x`{N#}ʧܷ9]fܢ_l_[)PӨԓoi:ٽc, ֯a={2(h[>LcQVO)?SD}M玁a8&lNHZwZE_.T'P{W }K$18)=e2 - %YNvWu Ywuy":@wXõpA{^&op6g9[{Py_tБsG6-)Bj'S^T8exeS|Y)(O .ܪOpM\,~@OI޸4_Y1}V͕b+R# D1*rx,Vggf:ZDbh(EIiŒd'iqt&`%4ؕ,q(UVa`/v0?OYo͔sbT$rZ{ax9my岠>ٮnk嬡䔨$vAMn;'WH2102lO _Z?')WXW4Yڠ6ЪI_QSv^!N qO>#h&+XƤ'O&*\f'{{ MEjap}aHۜᮎEVw=njk*R9EU{d9e:}K.eL(aa?>ԃR|SҌI ȀԒ2r=H]. R ?! 7{h(dqtE=B aWL~h^C1@9[{=^<l gU rHsssr+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^?{6TȒdߜl&HpƺzTAmAM$!}oa8wDtæ vH>/:23~Tc(+qZY*ifb1!P׺+K)AaPL{)i㥕#PU\{X߈S.K2D$B sc}($b=,0J 2#23[ >pRp{47ߜ9tZ4&pfd*;nc 60{8fR n}.d7#O=6:8N] x$.]4ӃUgqpc}SGONJ`O2>%M,)?XjPO+FU1 h}*ykR*M嫆C<Øv#YQD%-7f;bB ǷLQS)> W׎Hn\Z: s~T?h#H,k R(U(:΃π&T[52ǚe΍/Ԝ3 ̰EA6$c /AM%Z0GF>騋#iDȎ&=C|Ĩr]f!xlHEݿ,K-~~7?|b[ۛ]_EeY-{GA *?u:VQ)_Q嬽8e <B*wR'B4Z4ؔ “SU]D_r3j+&rtQA:r\ȇOTyC|°Q~kΒ6yU*UGG{AS;} o?ސ~UUHIJd#weO~cV\v+ix vhF R ؍{s,7ٸj)R@26"vMbnﲋq!AD; u:7&WlТ@%@u,u<#M ,t"]q_bt6m!',H4H,ϟ/C̆jT|F#N xO!D9b;Ha2:ppuRϙ'CvP<*@59ٿRG`OO LQ<>#|2hCD NyKkH>?w9n5I«CVT?É24S4IS7FD2zzd_ #<%w8!G>u ڴXⴏP(?yi4~_y\=b((ObL!̡ϔd?jH^RWzbYXr>./ѕ'ٱjQԑ$|4̹2U: w}?G["P;,8  ȍ=ܟ BsKN&Ӭiʑ :ah ޠM5}&2EQ'+4_lW"& Oe:Q lzFy!nXlGƣ(Eq''A+Q7C?va?W:?K{n_ojƺOb@h9m]HMʎVKӿNT+bd؃37%"b}JنṀmKލp DXE{k2PVg;IQHFO@s<+)P-@,؂XQFc$oFa<((:}>LYŮ\*5 `MC=bԦĻCaDy$z  JW#_I*4:k]?P<oJ˘?:k kYTv*X|8 {򌍽 &6!O&|jfJ[2 yRxg"SF'$F/K_z~ze^+LU.vrI$ y^7P 3Ğ'˅f;΄x+Yp!oSBDi$鹚-(HAG-/vgڈG O:=AX?~ e? *N 7Ipzovp'HzSb#&6pԞwK2PSBZ:J[,%|ydoDz9ٰ@ɇSe\w?}1YDAbCɴ϶&_Py[HUKou aXfSGLȣTrۏ-+$~4$m! “Ug̫>bTc`C`Ԟ۾eޑDId᳠S^ }O :IИl~e )5zq̨~PՀ n81e'Բx?8i5؁p3cGy$ -oUBdzMib[yi)v{^d"=NC@`vi 2mYO~)p*K @6bN…!*mA[#M#ך4; zd?UA?*&=Z*ST~5t]=u|'ʞouI '|}c~ Nȋ11|QXjBx%l%oZyoSMeJ6ß򢨠imT.BO8f|3\ A,@B_iqgRH>@?2қ#)gb1J|@Ȏ~ UK;Υ$ၱ2* 65$($sFC+A:8g9B;Y̪- ?^A'fV6vL# _0؃Fz(l!,n|=Ŕ11ju?w\>_0np0ԟ_ Fz|i+=T{zE=aA@Pyiw6 Q*3] @Iæw3MXp|Nޤ>׏E1H1e6JIirt-˚5fˁoeot,־1?J\!&Oi,6[cf(Q?ol)qO>d&*L-ÜQp~MpxOYms 㕥*c4$U;'Ut${Vu*<Ѱby#՞)}%HXL)!~ȽY^TOgU (R',B 6$cM@m'+c *F RMM"K{2s)l4 z£ ЯD5Hf<ٮ’1]^I&EG(ObGQ"]20y.ZHL۷u_6 z$)JoE]i"Lje> G+0b 3ː@c[ `~^i1- Ds &6RR|u۾g0RHP=`Ցb4إmb7ǵ\alӞe\r E {fsw4TØA[5'|z <9k8K"6W|t5Z&b72M_,u?a IMQ{ a8ˇ=4v.I A@ưTBH7EFtJZnOxqz==%mGM%fiHU,oePX poCr5p"?Hcx<[uobAaݻD/oE< fV?Ϩzgth&,^_ \XH_I~SH_,LsÛ6ssdM' ͝xcscg&N/V LWQBjfSwt/63`b~4 ogֿ.:\G5?q!)W/*IGa+}:ݾ ·gL%JiJ<2WSoxˋ0$,}Xv2f/ADI4ٚ&UQ$k(JT҉`GV .HЂ5xsM`F8\&A5ZA*",AA wL*A"[Cq;XlHcC%2p22#_?⍧Ș[j:6GJF<4Pے&?K4Up$WVx{n}?1~hcVEl4[q<|u[4tcCŞ h"(Qr M~"%@Th>J [^R7VG3up?ưzV axX1z.uv_wS^7No0~f?4Ve!?%~]V)C8jcT>yÅL-5 78zqA3k{pʡo5f,'A :rI?REO RAYrXYDs6/v&/?VYPCxV2`.溇UT߅X:U#"M]㙣U@1/d =(|T=ǀbOhiett=SžBN'p(YiĜEMOV3`U?Kf6ILS Ԉݻ<T Ihu3̙ |Z5ЉGĕ6(P#c+jOJs!a.>1LD@YM) J@m$ۮk0I;Mr+#C,2"f6i<uG*w7q 8|DjY]ѻ~(Hcމ`gk.8-DF yG"eOòzXU\CHG1M7cDL ,WkgSʘ*sW恵BrN ??|yneŗwFT}C~ah3gMY?E!:J18k+"LO^C8ԼwQ(׿ 6 z+uŏj7ޓsjPҕԌK~QDdu(J{.7>t7?ap?.*7 jƺ8eAXMu8UN{xÚWij ʍ>&፛y LkRS=4_x[:GLc)\[·jh{. s_|:*lj.N?u~ @uO/k,e,24"zIOna~fxRle <  w'ŘI<سswMLmIOMS#}At1s뫛w=QჂGPFvEib}|fd˶⓬y(}Մ5v NHr<$QQGYE\}Ss$ 0$t AfV=mAn@*H⤑HDqorKL6 Q;|*=BH= }At=e£2Waƀ]ZX{MҶ(Hw+A<<q DWЎnrTך&\\s$sB'OelVkM̛)4p?F ҼR~i?I@Ok{V?m'QMDžS8X W ׌IuC"ڠ|rn f+iWt/z]8o030WY"^{`禷]\{y/y3k A~u qeLߕ\߃9իt!vt˟W<_B,% /L*#7{SEfgr?EzNj4C`+54!q zjkuo<_خ.FsSW7d-Rq{55ǷjiǷ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫{`禽^=5Ƿ9W=Mzqzko=s^\{y탞zl׫y LTŌ!4:0R[wGsE}TxFF.~bDn6#~pF>RFbfA߳P2qE"8$kO9`*t&젮fBZa'J̬I}=tB!"<KsNV.dEܩ5a\I,_xZpU!qaqy$XlTo|?hhL8dwpn1H+@"k`B,tqhdt~cR$q$^ڂ@ 4M]|B3<+oPvj՘*u:LÌPA-+PI|9d Zfݜm$\xbU43 ͼ$BYӲT*P tLI Dpŀ۞*.Üʸb7ocۚ"jqe;󘜤djk[}kzȮ&=ɵ'’O6SуI`TeL(2NQM'oo5]7ulB#8>?LYg5\rÏ-ax\)0U7S)0U+se<&TOE`:䋥g }>tW`¼*lvnT96xT?S #?ޏamԾ#Z} 7gYK:j߳ k똺IRϪɿ* џȏncdlQij{-B1(A+yZfZ)ɗA;g2"N6ߍbzwϻ 6 #Lc"ߠCZtlWXz:Yk E/r|AC[pAo*Pv}m}ajR3<{q|6J]$h͋F۔<^ӝB{wJ)0cN UN}#]&\"27W o@ջ:O;[`O8t' }~?V `H@wFvx,a[B$kỈU4!RRc ^1tU=<g*j@I>Ң}*8~Tf{@3ðL4)i;w>O?@+:AH9",~^+Ch\\.0;Ȝ yp ɷmY#oڬb??^zyoFk5c%`;/|l%1sU,5RN.#hacq, 4LlCUj˕K1%"Jw ,u{gtÉGwpGG#i2NePH?x7RaURgܬB.xFnT#oS )JL=4% *!XRK"؁~n.X_:bMR)YRFlWIr&V7r$&cF`M?w7  ' q;O)WéZ2F@n-p,a 4UH*n:˘RQ0/ExX'Cc O[:#rϞ;OJL5'嘵`;D{viy!p?#ãޘv4 AQxzO:$48EqyDuDXh?qx5äyb3,^Rx0p>5 Oǩʓ)  ^_̸|.#H'$h 8_ˑY]F8Iԝm lĥ_%1V5Z,}$?lS&q`Ih#akyvg_1aC`J18aWٔ@;R1DVed-Kْo0>ѺOQbGV4ѽDDd2Dfi#dkiWIHuۚ꿕#X#N"FAPbzu5 % `[x'WPTDP4Qxm靦9$i:Y{ 3|gj;直oF<ݚtДsZYR&)b 1G.kGrܣ[P94__9\ntH W?ߑI)/g?:+>o2O2nbtWE0m߀))_ oWo:<(Bd~gP0u'g\:6SS҅XC+Egi?BVe˘#|dsc8O{orTMu USP̳Q)nfbFx%݃ XlGƃ[,7Kc9vby0hc͕nsMZr/zSJg)?uD(A33NgGJ?M`X- >y/?,0~s`c"]"".ӑCoMR+ a8KXzz GD+2ˠ(32rg6)Wz}$[~e.$BIxh}>X}Pۢpooױ$UcYgLC ZW;]6qbQ\whҰ Eb;Nh$hRa RF( })zT4nv$M%]+K1{_x_GRT#*>C,ӧkRL#@7˧@MU  ˷όֿ_;Ѯ' \>}RyW[buh.3#!'A}Ӭ6iB)< U=k5RZ~<01^11QQ`eLp]boe#~XiFS:DGpID+J#P$Ag HTɂ3O?%6!eOJmAB*ǔao?y/tvUvb0[;֧3?7:s5zu)c蟝QPl}SŐӷ 8qi/*}r^ʛq&eޮ*EL96*GE&?rf$7}VjЉ(MGU0hfo7oH>_?X 3DsTw\ʗ4}dYʸ?*6]-~rjK}{MthV?6og)ՙЅ*姭hd{syYjE/!N'VouoA(bFhjHѵ>JqB ȭ9x ~sQ[XTX$_Y~,bP; 56<8UurNHJŪ&rmHg6An[NgDgF5J"iZӏ^,k۸<[g_dup149^} q:GLT >KaOwqu/FIӜGxڪbtƲͫr}VpX\+ |bSO^gQOf!"'Q7=:rd/wZ7{ Utn/'"{i"[ڽyޛp窯SEnahӚ(}Y*GR?މ&%O,b#8LTel׶t*i |G~V/NR{*r~Jۚ3`}>OʢV{H.tZ/?X2 (9C2>eçP?P͑kJB7CS~%J BNrX]h3[Kqz q⧤ M$vr/qs [ lpI/ $@Ē"PAY]S>;[(]I9ר8'P*8XeC;Kie,ГknŰz I"V:HR|9L\ȹLAH'cOK,e}4Pԙ;"QvzQG:GmG2i->,Xx9ݫ<"U(`6#yuvR} Ԍ 6a :,񒒁7{Ó Lj4U}K<@M6벛uqyi!_ 9ZpBQO](oصDI_/~)Bl_1 ]B{*T!*/%΃^BgRKԍ]U5dXf vƒz9u)SI,x4w,idUL/ }5:w;m׫+:C fUkx ve7ewS<dÙ.Zڝva‚Pylgv+a G$qnG8Cٛ gBl$H6>W"͓e,HJfj#X\2:sgV!uH?'CEs9n2'7 JO }S :oRE#=H, J:texAJ 'ROYB} +8(cˡ;mTOT53l,,Qĭ<qc'L` Ür3JovaeE)b?RNHiiA({C_4*GK:h>'Y=o91b]'G:7eYTʱS6)pB($ii*m@%&5(q:3]ukuIq$ NBt`0#䬽_©*)';SR!y\݈k[q< .fUKOgْ2'_@G̴3pQ+YT[?7`g <+?szI֧?sj'󨏳㥵4>oKu:_HNskUZ//uhT QyQNx 9]F}{y({0Uf#x{i#o qS *g'FlҔ>U/VTХ~tE}NCuni;>_ Y9榮+榷^s[9l榯Xy/55XsV^_54{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{W/{|0k>mZ@%tؔJI`C-`9 mO-@I TN}FXV):4:^ALx gY)72{mZqQ̇??Kb5%-c >gtqb{:n+&2ƺە&++lTOfMmUH\]-pg(,v`bMoKL57G,w?U}yMH6{Pu2' 6VQXy>b,^}1>'Ry+!4#ؑܛĝ HVґpvF(%5ܓuy3']rl v\U~/}<;sxi5& Oi*AV #ָ+J#J9i`uR@?Q.4cEafK#B M Tw"?W¥LOƂlq1Ī@uo ZO]_)#cM{xO**O;ɁJX^56z ԨT?l/OUNyIXcPxf3př~iiǙ"XḾ$3vyXw~u:f$m"Nq|"o$ouZ>5edL1P zVPtͣ gr588F#6yHk5m0zeGo57948O ؃QUPx lnhIIgOKxFX"A{2to;fW|٦<5+I$res,>/xG&)KN-I>#PI~݈us>e. <6bGhyQ =:?15yw&Ӝ6DIdp70i[v;?\ε`1`6H2e4МNNTI2ٻ2㲊Q.Ȫ9t :_&xhgPBtÜT2e6#QlX< ?F:ug5T/%;%Gsmm{uf4H&=v#wZE0NғK #>f1O O*J7X{.}}|LPz_鸎jd0b.&q7VTJF>IzftuFċ /nt -Rb_ xϙR3\G!, |9{f.,v' dFIk4 #mW@\&-=1[$!c`H'uj6Zb>LqG/yx[rRWs^q}s bb*/:op2{/2Ңv|Z`!l;l29zB\u?J~{"FZ."i덐3A!Veq#Kb?L ۾:;rZ? GlD^R.p9s\`|6Њ$(q's.-xjT; EО2z@i_O?Ghac⟈f:1j=ZeOL鿤ٲwLs7cm齳B }{+èIIv#K/`TFuo-ZJPUR~Ol|8^^[E{0~~Iz,/G%9˓zҬS𚄱Y7NTX)5_` t'=b'hscv8=*IAFxkkvH\}7)p(ni 7SQ|V e=Lo r7#[\߉PZLAPJ$AGCWQEUe+l'`ln /Iޞ_C,7 ӹaY{s*Y?ZLX=?Kᓥ àèG4iirl$oȱk.XI'jTBCI N &J*j&fvkrh5{PmR@gnf>t[pOnT놪m2m'^*qRH.-E0BGM8Q|>|U!Cfߡ+5d|l1hsz==G2Vy/Uu$B}c='\iQ'3x7SsRi ta(- )2[{P~|+w+;%-LN3k)N(Ƥ鲯fz8m<p.RM)MȑAx ;UVwTHܦbDEy$U0LOԫn\i:c(%Wdy)qJQ$yqZ%" Tr@pP'bj'PzQ=R~ OM*Yμeiw$Iԟܐf yG5tr-/*QAb:(~|r[M~^vmrmc<]].TI'@ŵvMM!1\Z%17'h[ݔ(#R I4lgu9ӞUg\8WKL8Ϟ=MȴR(:x&ˬ%6 N>k0sU\#Q*=N]ϙ)%>_t8k,Ø/EklJ\g%ႊx.|] +m0J ~_0ϮT>@JF0G8_ZeK.0$'Rx^y7fTq"٬Ebx(1 HBQ~ÉϖLeUYb =*P;]bu NȢۻV-:%*$3A\#pF,S ʨhk:0 })}-t2:|,06e7oo`G4Fe ¥c4д27WH b?TXSf}nXݴz%TW)*4@t"BzH:5]^˳[?o(ӗ\JN| c^152jʋ9Vq9o΁o"?wv GAq1|E.#Xdur%TcV*Hs+Ņ)ړdz̲Klx+b鳪Yy*|Fh 6Ԕk _:0*101m.aFߞ?bL˞ZϾb/,HOmS[H}*f&aҼ1㽚W%e\_YTlt'J*7"3 hXnxo y ,'vzE޳N5HxUDO-u#9E=c,#xk _I-v/RD1oςHd)W`{)oٽ䒧GPR~h'JGDDbFKP?. cчܝ*Ԧ t<{_4~*qr!gd݂}Ԃ:r3Wmic?SnUXu&| S ơQ@TQ$'Ԉ4(8zߘvG$1,N)" $"C:_L}٦8i&]ZY&\{3 &Bv`I ,Y$R>^PE'ȲjQ4VЂ!KGUl6޺ v7"1Jّ-4"O{K{xXOE~2*4ۭYdמfY|Χ"?'BI1M@OoN=]Z[f}t;]wF9_gCK?O>m2ײN g솟cO{Z[q<= Ute2)v{^UZaIF'ĥIy?$59果2|#j_gCGo<-ُݏfŗEMu|^U&x,y/{C_+͖_}ݵ72_p $[[ w6ҙ&$NTI'3fqOYjvo؉-,ޛ(]4V2hIJ3{xY'.ܷU}7h|pGYߍřAЏKrRJ0`A6ƒW f-)ө Db;@JL0kjc}ܥN 8ᾌ6bYautoєSc=#w5q%%oa2-n6Tڂ8B_^QK$bģV/O"p)54P޶;hLAX@2 h},y24(gI@葉;sô,V$6шT6m5d>}Og[ĐDO|xocpK})u(E.,TrHT)#F97u!T,.I)X kYH H;`Db+ܝg3`^]ʒt *"@fpHuϮV'deCZ,H: [[OJZ9Jm-wfs={"+$e=fh7Y$F7S{[A.ykv1*%^xw XpsvfGE$I.cٮ_xqpTTPZ=,cV+ #` Y[־g.QMS&)$HENAC1,wNRNԞ#: -ϲyJ61 ;%7:jЏO׭|55M^_=,nHQ'S䰰'YGKQ>% `Xx`vi/1aVSPRN҃Dy8Q3=f5 LYDbXH'ǖ9~ĶpșG8;` _.0M x2G὎bZjBRc􎣅^fH A 2fbY~J9ƛb| =tzz*ZzxZ.YG|S7ɺߴ́ ֤xRG;ŗGRV#*>TPGSu~O:˒rfLK*B~Z8OƮ{NiDU22| 8^RQsy/MD0ƞW{v$?'apxj$6@*gl:mJ |My8P*stՌ5_5U_.Txu;]14tJ& #@ ED[ CHQ r"*6U)TI@ E5ΟLOG@K<ߐ\WRH|p[(k\goxbI#Y]\Y&{Gl{ ݢúH$i@b1JAN[Y~P~ݭ+u,p8)D{3u l1?3JSȅuSu7D ~yMHu-r3m˘zp͘nh9lTWbIQQ)]HݶErVߜɴД @PNΓ5n>WzuRRd o@_i|/cHO;Qh6~ }9I>\O P/į0K,q3kaFi\g.*ָa#=72|:$ēۊ>Cfᘳ)3T|QEM=սU_Ђ;y [55jl<׫sl{s+5\7dyYWry+=^o.y47R0LvR}lD6*6Bv6>&2m:6x8gA?a+|wo[e0[#TrWA uZUMo.x\\N)VPjPGAj}4yes k o';H>=~h+^iU[kv}M.9U5[k}<@^:bmSX(Udc`G,q[ZOy|9)HR^L hű T{%)g*d"i\V .]|IZZjYHW-M;lVNRq| ezՔ[hl/LS,kYi 0T=4\{ys\{ys\{y;{[5a.Ttҧ^-oE I;y樄O*Sʗ+O! F;|8%F˵SVé*4،R]@@j0W/ߞUyEx${OnTՀ\\;! p?'ʀG/=%>*"dž;/nJ wzz+zz+=Tb1TRdzk4MȽI=ϕ)Р#Λbh敷]db<?1[4[q&oؼMS>Oʅ*ߝ%1\w2Oo = NСD#ڽKlĞ2}jXIiPxjf|=o xJ|TRA{x-±B$4T5(ώ:V_ Yݍ_?3—}$A/RUF?vYs`TƤ|F r sw{*: Xݻ >q:b _ߜiBFz 2`fide ?"M˃Tua!3YFYSu+3WHӜ7kr[Q<<⸳ }a+5hwryzAM55\{ya&o;yEzjjV'"Mn+Ƿ4MX ǷvRkQ^=5\{yafǷyEzA=5`+i9*["{yafo9<ӑ^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEzl<עqzk^=5\{y퇞W=Mz+{a禽o=^ǷyEz ~@nqv媵:sSE߻J6 hhN PFU6o[ 0 pbeRU2b($’T3b#T>6?G$[VeAqqIID<68PQnZ*L[[jx$ E)'NIvӍM{^hc]&*.*sb6#IF7 x7cӒGCa[˧.WpH@.{{B\OUi')86;׹5i :yGHJF? u>4<<%Κ W؞l,*ׄȤxyZZ2K7%H7BD+e H5&eڌ[܏'L-~t@MvU lQíƴ0C)SrM@"APj' C[gh>ν'q M)T=BOp9&LN;z?5~W]DdUMo8Q$8E3edo~G LSPPm禽{o=5IHdI} Ekuȋv>0So[Q{_l*MJJO>4ZYm;/୙Q[W%A^Z'P^FxAaTC{o2k?:Mz+.Mz+{!!o{~\1[k;E'8pxRܖy%+,?O@^i_PGJux[ xq}M8YvWb{o=5qʾ g$Z:^Ƿ=xRM$v!Ey.@}yRFȁY3)U }/-N<´qm]cMV+,,qสI.#o , _&q٫𐟹M+-XT C8HZ* %U*MDM9~ߟ+[^G ʠan()mj$d/rr8 %Z@DS± Yx*55#M$o{ IF5F>tXI8 mGV&BT؝uYgKo EMPp{xKփ?ˣ}_go;)P'4RLV )jв,n*EF{dž- \,8E8=2>5؁RCS9<րO*(M8+btP<8+8~nkyӖ+(Ȁʚtݸ!WK f-RW%X{UPjM QΑL܀/Ӏߨ|3F1k#/1#|-ʢ Ԏ7f xBI$1'lp>Y`,KP q l4v3eXܾM-<>k{U&Ay?/g!~b]32|!I6?-܌*>6eJLabe%-P.^2\n;ix?0Z[EgUFF! h~%jZ0W0hBi2u46|׷nj; 9ckNsPu ʚ:yjd6eU<5+8r=[Jt>t~֢NcQcsMpXGaP,/"hToeu}A]~(H<=B~KXC8Wͼ% Q,x$ׇ9ib95o/TOG7":LYS Dž4jBnd61^k!-%*M.J`S|EjYmx]3 T#I /ǂ)ʎ u-7\ÜsUjj扫^2ViZA4/VE{y{j~S ZYN$Sj-2b[FxIƞ ڱ?AYF)>5B X0+1yRO#@aPSgzݔ=B` KŨ|z fMژ[2&: kycv7pxWނ`x(tA"mf7_i#)=61sVz_j*(#Ϧfkvemv6AH{\BJ(@<Է>g6Wvj8.BO &k4ܬ*Q?QʽrmDXQXjȉcX KnT9XeJGk/8 ^E_x,x$Ϩ3y1B= ”Sd.k$pڙ?5jNĬFLUK uL&%,Ai. ¥w.=4ʝ#ԙ&@`V7Gm^YZsԞ݀f٫|ʕIrrVnOOAU^5=(y`, ;} 4%aR ^ܥ^nw^㚭t@= jn{i禽@ǜNEqau^@9JrVAyX;MZ+;^j^]n+/=^9m榯{o=5sՀrxsՈ|緕Wo+4Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^^=Wעm禽{o=5syE{Mz+zk^A|)GrϱK-,GE]MqWH]apנF8jcs{3.== <T1h)JLNإnWãME0"nğ";hAu=5dӀV2QM:`w80eŶVO&P~oǁ'KLرyb uE'ǂƖB0'A' }DD> V̊ T{ D7api&t,n{7< h0ar4ٯ(Qq 𝆒yx3fB?O}+ ̟}<=2u~Ԡ(q[Ө_ڧn@4twR9m1Ad_^' ?:3GOM{GY6bGQWp_"(3{/^ZwNfjXx&K*$*rY{}&p_ -9|q47$pI%B&Jv>+~7 NzU4&1uꤦhbfnIЃo h-S#I[#J7*ԲjvL;ScQ }ܥuE^p5+.\Fe\vZܭ'7MXSu5h+XC\|9+-$œ0([B7a{L"O Vl\+ROP㽞!cѽtt9*ÏY0*P==rA[#N@8H"sso5V.N5%n52ͿڎC;64c:{;~|&H6tfgJx[~dumrHj+Wˮ ĉ6!] Z<-pBƘQzALxU1F4Ӽ 6Qy`_NTGDEGKM!,n;s";r+7)~߉J*4Rӡ F)Y<8;T&s)RiȮ*5piB<$6TMs2ߘ^ cI>8tk)or.ѧqf"*J=μpQ3]FdTQN2T|ʭ}c -aۆ*aqA~VkWƾsUnjk`WeuӜjnʷLrHլ5+yzVPfCcvԋpCoہ& KbōGGQLW^+es!OP6٭mSSnA0do{g'*cXDX*̂HiZ獖C$eHDpK>R6u;Zxb8*`F&&EDr@x;\?z;5Ӥ8|0H؎f@ua쎢tmnv '_(?pH^,Z2ASŊLtPIcTxv Snmۜp J3o}+ծM+/,/c{9?hcZ8Whۆ*F(F[#$MʍߑLY$se8;];q Tl/70Sb_t\ITDӠV⸇>%yRj]y?/]9{HU3̪ܩ5h&m/բssU`+r5V`s`+gÙ@ӔE{ssUלUyvn+gÙFn+gÝW|9^+gÞ=^`sU`+6rQ5["ܭV+3Viȯyzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^W|9syzz+gÞ=^[Ec3=^A{Xs =>zz+S\'W==nzIs:Oo[E{^'=^qW ^3YC߯ړ,T9t#B٧Eb=&+qNk_-NÀ[QC1#H`Xi[O pUE߰11A-jJ1#EM䫅ԛ_qej"QB,H#_0nKM>P1I7E6}j# J E%fM2B yPhg?$|³E3+F a݇@ Qe}P#N%>4em"> ֖@ŌS!XӍ =0SCwknlt:OI\]Y) RvQ=>{TBPUX[Pr@xYĒ O[G]Q'uo#q!N$4f*Ml,>Q0 Бq LLi UOثĢ;1G^kB^ּwN⾤}WXS&jX|Dv-KKPlxUb*l'8~\ 1נG73[)t ѾCNLp%f&){<^'blclzFS{}rcTKE*'dd9#,,UaNeql*z8IU#yFmҥp#ʱC=*E$J IFj"(*hbj,wx9m!b\J$b zO׈2p8^bԔ؆+_|RH-OK53Ei̪%FG'3K4qG~4{?_—/a,w yJQHi檊&QO811vV ~5K>fl= OTo ?-,V|<<̨4#eHI)7YWdW,XOke &zuR'/ s߳ܔ*0ss=2DӨmd8 ƱL\DLb9X8c $o#ÕJWR`\"[HmvTxg=[WDax{$'T-|(2LQ+)wxA[7 ѼE2tvJ桔9:)B/Js9A]]~{2@0dM7ť=. pK=J"%p:)ąT&wMOY{UkLW<`/SYD#%Ikmoɗi9% 0IKKH@/oll^܌T٪Ew}~$<ѭEznd>e^cT.AKQCSNTPS$dnL{{7::-=Zss~^5E̖>ZV#bx ­nǁ S&1BqGT=F2C pT5uZ4M2rpOJ@/mr UIj+!ZQ0aᠧ=\zlĻr~ c3](id1'ٴ|HR!+8"$M|C^=@IWs&=vf>N#<rE2}\}z*7M@zUG|+,agAU{RH0s2w^6iȠGGyz7ͽ pqj*C-UjLZ&UIy2vGUbRw0cG0P欳U%%TCWIS q$RUtu ;W҇YL<*&p˘61,ij80?su0 ;ߝ`Wl509ZWAr#Kj]?{s[ZkQ^VyI*G5Q͖L?ËJG(dznj8''>EϏ */,}=D}hxdy$#]ɚDRiIant´Ed~RРŽ4ns> sn<4²FR/~Gq{s=^m͕v HN!"*6X90FB-jgIq`sUp+#Ü{Õ5`+*WK*#8(ǝۚ`vq^7GWaX(@5dtTy]{y"MyX 0nfuMauxʶU1}Ǘ!q*vo¬Eq=8н}8">#QcJ:xࠕ&BI:SNʱq&'986J&X淸MnlǞ+MX DەpU9Uuj_W^!s^!s^!s^!s^!sx˞=^s_=^~Jݛ=^WPc'~zz)]I\$zz)'&Wq~zz+zz+9sʙŽzz)5Y,BWc$=nz7sMO忇=nz=nzW!ss^![EsLаWCcrzz)AIB,׿=nzVK]s]5b=nzsR9ss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^?ӢjX\Ds !hآzJoOGD"|z~4ET2GIT#w 1}יٛxN~:Jh>̕ /*a#K#YJnO*C_Lo HWSi垥2;@ky7JpLl]}b&ڲJđZEgj iQ>knǏvڡ$`|5w_<*͵xgQ򉮪*D*pr}7SsFMyfE;q='P꤫B`:R̭_4 [L>FI WQ#I;K2WKgvbR D|M8fdF0:$g5"o-3Ys4͇SPXGEXJzj(9"#dY]U(CoPØl`imck 3m.ucS=dsSqtaUʭ4aaYZ8y34PȠ͆XXDJZBx&xa4z@LϺP-o$Ӫî撃9鉪*ޚ'?$f 2|=>'Fxml<+m~4!|@4꒴p'>dEnմo҂RxmX螤FH A̲U¤KxxAPϺ 2 yt܃dQMȶ;"E )#m(/}hnoy›?|(Wiį4^*u,""{8NG825NQ5p&MTU;IT"FI<%~\S&nb z+O:Q=ZCEr٢{wG=|xŽ9u9S`pyt>\*MۦM8ӏ2CcS! )RҝX۔؎e9IZ櫦+f )::_ k:UK~:'}bũ\au #5ؽGĭf˨.&nEh.z tO PoQ0)4I !oe,?;}*\\`q0F\rc.`z+;4Ƹ-8(#j#{65NEG =WsW@S[s&z+sUzgn+9fd9Y{ 9^-WWT_&<ɴrU띅ՀsWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWT9{h禽|7mע|o|=s^mע5mעإ`{h禽 }bRw[9E;%qmעiY9645G+TSZr4v<sUTTMUD1No$;4'o"pzP;!c2>~Oja@@JgPD_”4b:57C"@:(THҾfpjGW>ǀ/cC;{ A+ Ќi/*禚9j%l,k=)`#)YAj,4n&i{77z+\X2A,4|9p %83ƥб@+>XPUUC f`͸{μX[q5{O)c?3IsGjY06[Ğ'1XH 38e*%>#4eƕU=C~#rlisI,tF?FC$nZN;zr(C@dqɧk*!l)U[ft_͛0THovGƠk q6k\l0BE^/lL [;3ꪁ_Ø** ,5UNݹߎ!!2GMԬ1Cy-:k{m%ԳOHЫ i>@<:XKC=|}'_ x xEFݾߠ8=Jщƀ^V=DA'd\C*p+($d0o-!2ᡰ6fJ_.,B9*jk)QokAvRJRBRq$8PjT0\S[Ѝ;DH?o¯?%!]Cy<8"/9;jybz:Icy+~`\ۇRHdEA*A 5|}Z`^}6eT'0lk$Кua#  2}`zˬ 1|FYܠH!3ȏAHATcgEgOuz%-Ўf*8:RIU}FũJHB)Mcfx68SmeWXkVm=*x\%$u$>?|s f*,WKEY6/C '-DM*aDUU}$Xl-4يzYPC ;pٷjq;(g]tTTf wFq*iK-םFF+Jz+Cj4[0G‘5?TX&Y\Fc_&E<5b;Xy]e%HT?KU/_s.ev]=GKۊL;x1 aM"F f٠׻% TQY__R?δ%=>9EI]SY:hEM+1oWbحU"B * ?kNC*)c[`OW@OP%ќ׾Tŗ2A%l5D&EreA'@O(h'4i0oK/Xץ^๧fjĨhW;k$%!!L7 KQF(:ς dI1TRA;;s%WBzg)Z\37"V $FBw:}ߗNS(Ug򕕣<ٰ~T׉u#&tRz`xKUt F*y'o"?'(bƵ WOoOo$k (i&?g}6"nᥒ/,AZvQUчº=yljO2 ALf)v߰IxWe%S5o~VދK@oKN>LХLn{ iZ˷ӓB?RT~O<ݛ,|ᦌ1 W#ct* 3oˍVɽq8\y1^jd!.508EâUEߑw&3Y/9g7Q1Z\azx!O$Bi%L ҉Fk &I겗.tJvd5Q%MBo+SX VQڕE#QMqWbOUdh.X.UAgWJ'}CYbNC1R4IWPlӃkt!8PkxD5/.7^qserW_anRT48ltqnI]A$Lx#Ei)6\o,ZK(=~u  |jY?+F\x[b 7\1F")7-sn>i2k~-]'3z{;Ou[7a1QQ̲ɄSFb(HEAYBƬyb+DOB^3Ty[ӎA@q|JA'(5R1:[nki2 r KTَ x(_>b)n^jJnȪ-ʓVkMh _~]1|aip,"h:7"긝{sDe-9UAPvYػϐm0d5- <5"1sQ{v4Mz_VL>껥C%IJkb-j"aIp"X=T)Xv[SnF<q f^ ǘJZSRQM'f_wzZ U ^~OplIK 0=vY,M|ϖΦXY;Yj8nuT;_AspvѯE4oo цo 0 0$Vx0 8[Cʴր] M=*)5.E,J`I* -T*mqf+2xTMߜi˯j5T_Ü*iY& |=Xqj9S9l3[54{s㞚{s6^> =5\^Ow;93Žjj½|9()5yvsS[3[55zzk3AG55xMN+5+3a55^>`榭^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz/lר)XǞ9Q^ؑk^~-ߛ2[2v+]OO`G3*(/ c`-rIKoq콇`)ki QԼIH$=MߜZ|(qiHҌQb}xz\7As͹R*W+T,{Àz\8}TcA& BңS(@O0UnnƫꂔyqN?>T;Wqjz?7Qvq$ =(qY8tU6w7pbq$OhMyk-fF@Qscqrq02¤'6ܽ<*fV]ә ?|#'߿R*B^{L27Lza19cKy?a}i?!f_6ɩT  KS9=A֑C7C)d񆽟'=cVoE0o W2G\/-9oL? N{DoU?=2o en9ǎk-'7ɇ>[Ƨc:8(Ús.cdEhJpnRݓ䔚VXvn&=)UiB#_t͕6l*QQ!yl軙6Psw~͞i!%[A0<5-Żv*eהVʔdq@IU.զmyF7aAQ.ICr$6RdC߷=s^ ܣ9R9.=s^~gÞ9SUdS=s^2b>Z5lרgaW5A#Yk>lYc6ttSY*.DE69݌,aXmJR*(Ms{1̟mu ¯җOnNy&8u~OE#n.O'oi1Jg%C%Lo/Np{ W?8O=ɿ M{.y_U}۴˿iOO?f2oS^dKW{}۴˿iOO?f2oS^dKW{}۴˿iOO?f2oS^dKW{}۴˿iOO?f2oS^dKW{}۴˿iOO?f2oS^dKW{4˿iOO?f2oS^dKWfOD^'|>2ްE.hY YjE dȾL϶ݓ䔚Znj]qѿJsx:}%t?O.ι>9ū%YU+Hcڻ*2Жݠ@LɁƺ%٭[-KWx*2`D <*}{`Y;Qxm6@]5=n}ͅÇ`?O aE7탞5YtRGlשc ^MzyMz+fڇOo=s^14${`禽EsC5G$/Mcؚ?ghM=Cxs" :{b?9y1Xg)@jGMr m3oϲG ل3POp~1Xk?|v_ꂢCqT~AL7o=5\҄Wt ?ErwNpodN?boT)_lV#4|''W÷iWdOÿDӬ,}a$]R3fQ $1s_l:=(Ohrj /Ikt %1Vys}z (m`s0*|onv\nze*z{Ajoz\7J?˧ڿq3 #? OCO:9}VcQԟ'O2LA?a_Q sGY mt0 \&J/M239)ƟmHoOa_?39fnzx99UN yK+*NXfo0t$&%);I'i鮉mٞXR &R:*=Hayk>WO]0ڈGpa391:r1i) 2-ϳ9PԗAMz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>Mz|9탞{s=5zk3l׫gÞ9Wχ=s^y{`禽^>գ8( \ʹ0T]>J#mQ$ŽжטŤw,uUu^s5{9D=ۃ~$+jv〸:m #qD OC(uy+G.+I''m;*qn]fT(M\W7߉JQױÕ̷Tɼ]hqiJ.1+>x]3fC9]<ocÍCc:—$SYW= gy6{_4^b cp2d۟x(m<>~"p09$'v;*.}5+?_Gel[ck͡⻿  qi%iՎT^Op ;{k&k YFux÷nJ6aKRvmۏV 8eFO탒[Zu{m|:֪sbg$o2Fݷq{ۋ<*.8A-΢$_=K|9ߋ wÍoS , Zu77Or_sr6!E5L5L.Qv7P㭸 :)[*20=5ߥ>IrQ=f0iv %YyDaS̖Fgk \Wh12.ǹ7 h[l8I6P=7 j :gm|Nt`_9V 7<ͨ_p!Y~ҹ@;i\xg}F}Ru΋OoR=;2Z LlZ/7t8PP(hږG9ʩ*q(`rH0_=mRL*[k اrɭ4Rorx/ NzvIsmbG0 seȓaЯ·CkaLO3aDs_t{>vLAb:+ynj76 ^G(CP ΧM{q LQHpנ(Ut(`/O2$(EQ@TN;{-1)1l *ZC1h2HR~\yˑWm#KjcOSGY2#>['<#4xqW̓gNzVF׾9YSz-Mb]F1Knq̛+5jOׯK՗W3͈a-'☊LMQ*IP\He.Tl7 ġjO2F.!c{7puӿ&][Dj A ^m"8Μj ?Od5=z GY{÷PAA]Y%2+>dQ RA?h AeetPt1qX+,C n[[9Fv)bGGM6KtF9_m79EFH +aW7G`lk.c˸29]RTjERPzs?g.G nx?O4zӌz[sbYaUZjtt]$C c.gA@U'S•%[7IQ~C E\)RDm5eq)]p J~:H~?JE8wE??g8?_VHrUzdĪK;1p$oJ.Z;G0#cIai?KUP4֎;ΥTG+X/ l^ږ'P0(X:9K26/1 <.(i }oEp[Ets_="ƺՇe:K%YGC#-'6d̞RK(W~(j#3*9 ;yVSG,BL> 8bY^)rȭ"T$8XnZW4⢞X!@kBh*,nbMe"Ti}Ֆ=`$1)!_٭' ];oB1T?߈6RE?崓:2uӖTv \Lȥxxr\aOpxTRdSHPX6<%4iKGbl;kߎbN4@NaYZYe5#aGj& \fWs~CI72EsrQWb;q8T(|FUJlXd[Uj׫n`yznA1kj׭Zny FnxWuNnkU&Suy5KMEU%o)sE8kQNa,ubb@>9eNN5?_$Xj'9B)O4ZN߯@tr5VH}ܔ62M8*1y`榷]sM9^oMz̪^sA~jkb-aa2 r[5r9 9lMz[55z{sT5]sAxWM^l׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzl׫Mzlש6Cs=5}A67zkJ:yfUo"Daps {bx|(vaqi';.'!O(lLGD2}%EIK o$CU\6TN^V^{{Wz^{i ҏbW2Wq?90WW~K>I<up ǚ?4Wg?ŷ_ז&bi3k<8;!)d:!zkg 7F-lש{zkՓ9S&F@zkgXzkIMO~Žmc84|8- [L wɏa͹'W]~{Wz^{{Wz^{j O7>bAD\~|1ȯa)I)`{9mF(q>4@PQzBe@\̘bK.Oº3TWx3'*~`Ohg7i_M_S\>Ӯj<>Rr-c:!lר`NJ)!SMTƇܕ B?T? fl^o8mrRQe+ ]#ߙ'(?nR`}j<"v>!R澬Fpu@ER6>ďgޯĭH)moo,䎐£uI2hKQ,}8*><"Y36K m אel~1e(Si@fªECawgT}:Dt}c'h!R?oǁ;$1۳%03ʹ1eaJ颮#bǺ?j 6lR +¹K7qk^b,o;=ϵE $H hs6\xف0~T\`~4TQLQw'^jm0b8A x/!6>82n)O'nhĺFxRڛ u{Ê*L6gZjSabH'`=-g#FhAby\Qabx`Gڝ;[\J.fxo«EGM' pš0yH6᧴_8[ǒYهNU`hLM(i"ko'I÷gx&Y]}-{XFxZF6,nnl?gTb&.$@[$0SI$xĩG<PX?$q$|UK[>GQ\t^5bbԐdsv w6RF$5$>U?R1T:x&ුe pJ1I B y`_ A(ig! ?Z٧˵XV1wNՕI:ݤi\o5p8*m4çʂ8I'8~4,5IkFE|ni1IM%L,jHkaA< 0"*].Io"e!@l*|x-Lb8 WY?(eE0ml_2lp 6>4.JtlqIT5S$>Hy,\VP,{2{4[mħҝKZ!*YlH[}XsvHM6Em u(O bxu[ c]m2f" /x–0nuN* ʲ/D>zJ>U-&;}{YOlk ys5~RȟͰ|>'U>p)]e~sP=|V6WkI_3egYS!~j, 9k~dvjַ+5h8'FU$M-W7ގs¬S׿^*=0,_pU[-t$=4t K~3*blOEkp)xe ݑ_!lOfLAKEI_[VCrgrKM\E(qETК3' NsmvpL3-Sİju"5z0ÇmQ4 Vn+e,/g]SČZ9Zf;~#SŤ+$<+^/ƛ?⛓2^Xɽ<;gzzR906oxr|-o9#q)A5!ԌC$~*8&UY/*d4͖㶏D岍QiX䄊#*E _,jiF87?䍪ɫ$}6u26TҲݖ vVjs _at:816XցvzOo+ ;I!tS1UB{d#'JşaWkUcs r}L="5+{i֯!G߇Ls GQ  HVj |BpZ锎XqWDf$%tGP ei@gL#~1&F0I!1J6(Y4r\:n*{ʎCLk}_'4}nb]G٦ĪZ"K|{~ УaMV:oz_4OQ'_(93pMhg܅[vY+?|zΟ:jk) qZ$) MKHCPeMk>4Mz&_6¢ pZ|۱iJ}VH=C¥=,uCXI3)ApC bUbzy7&k|}¡[m5rLtof"evx@g^&k1R9vk5"U(H@}{ {<Ѫ%Lm'JI)J6LKDvr; FW7FdNf?k8҉Q5]Xv*}{ U/%j-Χo6z1ss}=$ʹ$dI=4_Y+1/SZr׿~ax+;Pn9la]ۿ~!U.Ir-Soo)Wǯ0$rMs r/JYu^㔫ldߧ_尿E'6O?\*yuqMm*.@J AAQ媏a#56Ν)9퇞|Fzk"9퇞ezkԟɓs=5/9B8{a禽D3ckkO[ phם3C\mZ/>Λs/O8=^szs=W=^szs=W9+ xGf~?'G*WӘ/&"=.ӷ<@?g13s Z>u@/Z+5_6`H\XFjJ zs!+l<רe,zk&{a禽Y퇞0bh=^9v5?ÞyQ br5o-9[)\?5U?q0|Mm5j6C=omOVsWV<=^szs=W=^szs=W;勵?s%u"mG{>rqk?򺣘)Wh_O}P?^%=~u =Tmy MMTɎGs=55tzk!DnyVN{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zk{a禽^zkפiR d;o9l ]H p0ڼAK#m\3E&E.($cN2YUN?uqjEYLh׋]KG(ռX.qLhEu@Vj\KmI\wG3>3璡]t*4׷eoTxj9C{1%smuDž7׷JX#j,~Bk7]1C$SBpKbߟ&`|m-|x.LAC=T |.dÁV%݇n= {)eJbK^i-a4m;F)MBX8XU$O(n&b\⊎YarM#^v_ /()`mo _8 J L |u*NqXhJpw\ah+Qz:0޲)ߏk#8@ŵ-GA󯉿 Ux;U%Fm;7O5xzC.Y=QTu"jm{\ xOiDž71śƊw\`5p4X$ 2Gʆ9)L|?Ufsa¡Č2F7bnjKr;}4o+pʫ`Hk;K?Àaj#E#w%p}qchiwa0+i_W=.oh+c\S4(1)ЬTX%ڔr'%0ڿ ʇ_-0l+ax4b6(BP.}!~Sۅ{(-cmવIa$f"ǹnFr&pTWqP[=NΚ\>U/-ϻM$LJa59W˧]$/PZ7ߘjSӽCEf?PH@(W֚$2H@D5Ti_I*A\)%ޞS &96$n100-IGzkd~¾&_>ގdƒR4a)*Mˉ\dy5E^oSR*RĤ3Nk%UWY0 3 C "o/ވdoLʽ-0L.=2@$oyُ:oUb…*i?KAu˨llv>cOak8gJzf6[m?_n>BPI?D:[˭9Cx%\°JzD2qG4Zhm`NU, [8L۠Qˍ[\HS+_ۆaB- մÉn`/#bJ(dHϧJ=ޯfLR ]>c]H kxrek e2r҇*sa+Wc҆|P"j%J]v}NcpDGpA֞L78`BRb/U$BJ9 M[],@!,7}<L]M*KR =zV7n-BZUo~;ūK E8wAn4& %2 tIf5Kj ̐A>۲Ƿ*E]'III9ڄyV>9ӡ0kn()D?r7md#kk~)h[WG&\W99tCV5J_'ya<Ȋ}6Z0e墷9Y_R;4iUZ/@(yމ5g^W{ħuaòncoS$OSKLF+1.mo`r\Sӕ~Pr>uQPeG&L X̠>~"tRq1Fk,M}$ʧ;+7;(A RCUWWA*)+B]@6ܩ5hH?M\+{J -<؅EכQ_@>ٳfnċF!SB }! uŒmє˿‡*FlGe#ޯxĊ:u?E[FJF}.Ș'L]0Uwu<8Tb$yHhGXbk/ ?=:[|BO߈mAsOqw_8*o[!@=j}3{Xy.!<0I-q)CE+{n/(ze#i]y,̞ٔt1Tm=ƺrAjڌê쌧f774itEBMT@7jku{q=;ħm+LECbb9y .oF8Ek<۞EmngH}~6Nmc}9rY9MmpQ`=FS 8T*5CRR xJq>ʖH_㓯QJC b4iPqԜ)#8J *%&5Xݮ-., n+kHU=5aXΦSVemnvSVי{55jDSnT{sz|9!榬+ɯnvߞgÙUMIWχ9l<֫gÝ6榮+gÝMz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zkԛ$ÞyQt{=^նA.׸N? zYc؎ G1s ֏}FvP?BNzĕw |o,a6Md]:kfMzXѮ퇞 {퇞g>Mz1Y?Btzk_3iMz?V^-Z}s z΃hynϿo)Ur/l?[R~:xJ+j9)+={Wz^{{Wz^{ii bZ9º]>TH45]Që4hοoQu [i8oBsS]=͹퇞<'O{a禽B$R{퇞d>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3l<׫gÞyWχ=^y{a禽^>Mz|9퇞{s=5zk3ŧ'tG7nHpqVaIo4[v^+\(dn5]j 0&a 33n^ۣ3[kJ`O5&eq A@шVVZF>I²6 Sl* 4_\6N')f0D0t줥f'-tNN4x"qhAP׻&e: 1Kź'6!ZcӀoZLR&CE>g->GBB5#Pe4h@#&:DE."xqzy7-R4VbIKp VRAT"b0SEB.HX=q`u{y3l"/wP6.4GeMt8TµпP ͗n S?S^&c`0~) )eҦ@o«cQA |N83RJ=[y~U}؍Xx hfa)~\C $tR:bj7}焧̭vwRG'JlT;k@oV6b2 ,gXX} oCsU@]}=@k0&#,wX"b;ٚ@?'+S; 3ɨLAԛX% 1?ZB"|[LE"u0o9{F^Bcpj H)u euY%QlƳ]&ܲPa$EuGׯ*q' s0r{rON请5d%XxE炷3A%l`wY]0 .[hAAPGU-<݊2V>5Jӥt-*X"Et"Y z?_1Q*ԟ~>4>G_ZjO/jQ:4-}ut~d צ:'ұ=CF&iLqvO#`>+#jωƤ6"@JʌWEci*xQv)>_:7N?il 7u?x'p^87ZH0+S6 q +pks} J>T1|[GۚzJKxWؠrVɥz*zwNt*dN`vZ()* :X˂56l Z:(K_E/GXÛ)5cEZaMM8RuxҔa_&|qlmx]IR̳Qżu@  qÓ~zے=Mt+)l6ᔸ> c &Ք9Lw-jJxtPѺTA?3A2vir$4pe:cUe*6-7h!+0B%q9 V?U(7NV_GF͇\H4NQn?oqiZ$:@ŬJ@o*TjUFkw\F3†s>mguZDN,}g6̱&ϝ=VP59Zpbqb0e[}5t*G gonقÔr& v EɉTc Á?2G=M9E}(Ϸ~)R.b4EtL Tfjb(oۗVTXt}(b*IŤŨf05:Xyht@NPV7s njk@WdC<ObYoT*& {f>ifM2A+|PQX{jVE{Әr.1Ĵ[4PUK N źw?C FL`tdN_@CD{[8QFrēIO4F6hrq8n2q:Cv_4_ڂ<9iR6kFqIʠ n4?cxᇼ<@Ñ"[3\Ҡ"VX}{B]wZg ]}oG,f+B6t oi?TWEVU[X˫)MrlĂMOJkv0 j°s mMn+S~wU띀Gnj{ўڞPPySիX配ksUa]s {9ע`VʬDe-pyHƜ Pn 4:Po͚kn+ג#q6i+x}#ğ9SVi M*}LJECR>' KjXys^&Jxo}G E?yqk}9:J)UGN ~UU+sS@2*TբmVO=[i^5_o*jeyIE{_!˪,V??.m_-`J宍/=W=^szs=W=^szs4HG1_+ܜ|+N%b?M{'Nupv-4HNoQu g _iyMNN9 {i禽mN{i禽$E9V^{i禽ſ{i禽]yE~_j'K;ŷj:/hѼ C(is'Q9<=^szs=W=^szs=WԓE(GCᶭ6nopy{?WLG1zŸf#Jy#~"G0s#HQeo^U0p~ y`;O1k$b=9&Mz(cQ{i禽&A}Mz+>綞zkL8m<עt {i禽AoG5bWe?.zXW!A5GV/©ڎ}IMG{Wz^{{Wz^{Z£}Vdqsa};W_|sށdl.k?򺣘7<)9-E֞~?]Cp<ȧyE=4bJfq>(:Wַ1T%{R[B2(WTa ]>Pԕ ޿I*V)'}õ&xPLG _2De2U~KEmѰ`=<>3JOtAC%雳)ˌyp~HB r"<1!dyFFHJ*V {{:74r,H#Da3z6y{tR`I*h xׅhĬ;$u c2"{x̄. W N=p|iu:Yݭ$*U 3N%7m~Cݙ4#$żG ,*1g7v:'q +RW|k:Uii0شAc5&RNvƚ'Bu&Fړ \V>m2~i1`0Id R}WI$.$A#• h`xXA%͸=ZT 3Ӆ pn1© 0% G|Ϻ:NO̶6ŗpR(.q`ǩ?;?v.t Ipa>'x)J}# b8ЛZ:J>Z )vDafVSA=WRT\k2}/p%hSksm#ios_s2zх-8i1E(Z}&T_@}{é T,o@2jzH¾]1Az4MvʳS=r>"u&7gĆӧfvG`{}o%aH"^W[Ei 5.["sY F0;ÈķiI%A`[drYe(| ~ 'Gv_p*ԯLb51#*8krC*`bv̬V0 #[ZÄsGZb R.тSI=wNyT h1._M+h#(gx؍J)MOl"jz'K/L9W ƨQ*Is .sSV3Hmνբk}hepWK9sp΢HXd}f6?1?nA ۅdoɛ 9tjcR Kyc2wʣ B7x9” ۋ) LɁG945gz=PR|%# j (^U~=KWp'@,eY},o[y75}<=E7'NEzzf̝`&c>hڏ Xij WR!6ÎuU9Cɴ,mmi﯎JQmibխ#fe[1ja;q4TGIOb~E$#J>ꯕa3TS}1&Ao*]t7TX_vvR%5&LGAj |fo1nt lb'^\>ۙ6R+=jn7Ad tU" }5Xߌ/.[¦v[Gzqhvno{c~JU!#GO'7){^/Luf_ cL$aPo:DPmOQ'gQiɷVeG'$`th*Tz'VMM翜Q'K%xfO9zjGn5 hfKIVt/MRʠ(`5_&Q>g9}eß Ynjb p5 yOY"p,~eOў]߆8 tvjBOZEJg1(FFP7#*#)VZaFN.O9](c_;a ǒa :~2DO 1e X}F]]F1OOv E+:D$xRIbf6k}ugoŪ1eJ8娌 mYmksߚ5b"%16̳lro@\V_(0/d~aH;<~{_n~89W^:1,o 0|b'(zx4SPVŻT_&=@7~[#ɘ2uf`tXU6 54aK=aX\ʌXXM<h!/T(PĔXNa34Tѻdb,30U][M;%;^f[Y*i j:uuIkrO"[ޚ4b`4Ej ];a>:M@ًTSct0&s?Af8|R ҧҗz0 Xpw`RE/OUO&i]n6teuV^k)'o-CyZzk(F0{j|rT'Jt#ۏ{V[)KȘTC1cY֡Trl ҉ssܗC2iU7 rIQo8{Wa[1 @ [@n,1 klL$vY7{@kb-̊R*±PY"YAk{GׅNM*9c{U ]oi)~,m0zcH2:'S)v=rE4%xMsƔQu)+A6'Ogǒi2}>iiqk ߙWtlIrñ=W]F/u8ce޶$_Q[Jbh/tWr^iU9W۷<n+۝WȷZW{ոs5JW<^+jn+9rs%ZWݵq^+shM&!r}ƍ8c}>JW?ǚf8>CUc7kX:+* YLZ9%]n{Wz^{{Wz^{i ҏbW2Wq?90WW~K!c&˼C.jqөG9z(eb{o=^"u)ez)u=E|Fyz(]Ԥջ__;$?>vro>uy2km_?MifK_(rz^{{Wz^{{W*E gD}`d.o1?,jӧD_P.Տ9_dJOn{a7Rc}d|R,\gWZu}z%˰{o=^˹omL8u]v9{o=^!U`a^3ݞSh_ٸ&3yxU?[Qϩ71fIhzs=W=^szs=W=^sKOToヨރ̗_.>/os?&U*G034hN-*.@XN*F~.}pq$=E,L}W4m\z+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{b| Gbm9$mMkM{̪TqZ+!:7SϟG>z:yP 2Bzc[6'ﱿ ")_LC{Dd4.\˝J)uA=5R[s▙VXVG$X{VZ0΍Swz$I3>T(aRSei}>H6<PZ)?^3K2dؾf˘C5S:Mm <;K#Q-l cYDmN痆##4+<э '/$ϟMo{r5Wr>b # èMOLJ3Fu%IPm N_I*>4;s#WGḱ8> z#>u \[,zV5k<QXv-cԱį qݶI /C}$Wշ%owJs]uwʜ3XGHU^RQ!dwT,s5$h6FM;x-VPۨm6i:,1~-]Cơ1JiI̸T ٗ >=*Y`}m 1$,mPyz]y|}H0 ITi7 fgé% TCcpŰwPsXp{5SZ PY(X3ns9˧t.+╔1bM4RKL"+px[bfHCOV{o'a2rvj#om]lKp>Zfs SR lJU$ZR- sY#0ӑ,I,uZfwl'h,ÁDE_E{]S>zeSGƊycMO)U( E.A`voI߮N3[3n^Q ωWEmWGP Ų:O {O$v_dPb!| ΣÙPTՅPOB~fl#ԞKIJ{T:{b4H*oQbʧQ \U~ XQLҿQr&?Qx5v Q+r3%bFf~7Wtے,dWIC0 ˞Aξٔ F _(ՙq˰nO炏J}+JUoR/= /9,r-"R}̪EQw|=RE#" e,A?Is%+8(MRQ ]YQa[glїLcdLq(XT@4$L[؎Ac,5crIkQ4Ll_}gYzl%aX~%U̵҈i&RԴo$ ˷gR;qzQ MAfᑪ𬝘V,Cj)I 6 3k'xrq[\v`7%鿥bX%P)TyΧ1 p+^/FVޚ=W?rnUSҶ%5BI4pj0B`.u s Ѕ޶=gz#`a-]T5QNc卩eWdKʻ~(iTqK \11`5Y1B_̪_(E\U W` u#˕ft ]b+Ş:u%uQN[x& Ju啕/TG[A MU7 suӅblG}uJRokQt*3_^MV~3*UdRTWcf=ێ.I #W[gX PO[ITMT@FU*p#*݁:qفGL !7YJvG;iQ6}ee7Z#QH59F-)}c%9JB4,C#6UFbĢ@#}ܶ<⩤H)k;\EqS${9Db%$2VקXM25oq4rOTlpm kk*hpuij֬z*N'M5YR >;47{.p]y;2g)W[@6jX=myW" yz\w9sUz`;euxBu'SkqStR霆c{h8M:M}"o ז+*89D [Hמp{¼]#):"\'4W~gEc$ju;rh[;=VUs=n+=nzqcVX7rQUs5JWx y㜭U⽼s5`WqrEa9V{xv^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9s.?GWxqys ՖT5{Ϳq)|.ntWL3;Uൃ*sL4=^szs=W=^szs=W!;>drsa:ė_}5c>G9Lx\jyn+3a -*EQ#j'-|9vST.cqzz(ƾ=nz!Ga bysX=S+"ο=nz_?F=^#=Qj7/M;ŷj:hѼﵷOD=4qG_(sz^{{Wz^{{W*ԿBc:>-2p׿G];qwz ?po=i[|'PBZO4>8/QGncddPkqߞ=^5s1#_{9s,[EdW1L WLѵ=^#}P#x檞]Sh_ٹ&1$ԃƆ+9#-W%>{Wz^{{Wz^{i} UmK@OWº]#׹3]qv-4H͇$_`?n3-4|9vST8Qˎ<zz(CGWWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^[E{xWs^9soWzz+=nz㞷=^Ӡ ^srkQ[c۝7Z:ӷ7Z.{uZ12ߗEsR8v:n\Q$N ^M__i6Vx x~^_*DS>?aƽ顷Sj&< p"9/7"ih:/O_=~-N Aa&diQJc:=(.oLOḱa<bW]G=F;Kb>$rMڤ X3&.KIa i,}"DP4Pip4?_.0LzVJ kCF'FN#pZ*qBT75(ӄDҴh3PO{^{ xp}ȦF$f}ݹR*F)=g=MҨkZ<}ϔM<6|` \O"۰޿DŽb$"BCיN`Qr6qmt8rIm$ODŽmE'R{elT;VEVUF`&(EݛExU*m \ PqDcGTE4e&0v=cbPeU0RdJ[<8]t|zyF6w+C4يК9#O![xxbX?%~#ZС ; xŋIezH3?|p@DaQ:J<1iY\ e`mJڪV*Wdmăq]aDKu3C x8n(1B"L^_#K1Grǐu p'yc@M,4L}E|]b*~)?S ZGXΔ(oRЪ.DŽRZǘ{=^=nzO*η3RA9{|Doys?=LOۤu]Qxc N|.,8ozThRt?M|tkh!c_Sf'(PÊW4tL2o&R>'O 'G9o }.Hz{!$.ۋ a\)1^em->}eY{ܰ>wݻ)Ჸ>b #u '#**h0XUS+v'C@ׅh1}bNld0#a/kk Ib}`hKByUx^7,w:;D=fPG7R JFi*mK[xQ'QLmFfbdÑ^UF=­pmk|x`i ²ӢH>ŏ"fRT$4~vt(ZGQq Dw}qŽ$0~&Y)BpQfb$1tF{Wz^{{Wz^{`¤?vtU̕ON>ߧ_尿&ˬC."Mz)pABmע?9S>#h͟9Ey<+ mעQ3JKwsUQzdGWmڇθGo_nlt+=W=^szs=W=^szs5Qǡ}DyO,#{3u?d&{*UiyB֣͐9Y^NpX{h禽d ۞9E. ;۞9Ed80sG=5|GPMz(9^6;Mz( 5,5M-;[)aa;-Us0|MncVM&AU<䎬{Wz^{{Wz^{`¤?vtU̕ON>ߧ_尿&ˬC.mע4mעG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sG=5sԠ[NsfK[`TZ\'vyW6s=k-  [W`*6Mj+ۏ$ŵt~4qFɰN'V48V 5r_T<uOΆܕ62ߝ=C KO%ְ3Q ǐK"%N뵂]q47*PNO[Ut I6Vm\.eU5aߐ|SdLA;a<<5rR0 {M7x8PjVwIz?Z|Т8zcMic\=9C, b?t}bP@=:lP;I8ЪeXc%۽Mt>N*0hSUڤ92ColGj IfBM=_|8bL%蘟+TG&[ WjNXR<<>[E2GZ[~f`8ql;Iar74:eGQb]=M~m-EHvOP[o=s^\y탞zlרz[ tFS7Y"V )$nl׫1ko޸a5sP`1GU=Y%eTꜯu)?`/` lK=Ge?Q$b3VI`3WSPڜHI4+em[-SϛH|Y0f"/N-^ x!oO(tj+w֢dLFf2Ί{Ƃ(l@#7m=ҫi*Rx Ftq59;}8_6E F]0#vz 4<*}<[/%< Q%Avk,;XfQ?u'zH}HG^"|O~%<٣i${LJ D@O^Z3@oIk>MS2Y{/+^h/r:)5c^ov*)ӜǚẀ i׫e . )+ ׷*iA:@:]6as^V*⸵ŏ2MnuAk9Jmmy.emە6KqO tO$5DX̡l4Mn+ζg751;{*( H I'wv6 j+-\}@̣8R5v"#sw 5!K CԍyXNI^E14ʅfF;$ᔪ"vƝ\GY3![ 0kٟJ,.-J5V,7o%I":gƦhGf6ۧ⌚j {}5߅xN4iaMvg]ڋxqY>r9)}т˼-6R"u8cMDeQf UQ%H}_xcE4R^-!eC([8@G̓~`]xzk^a55讋jy 榭vt[^6M8cf׿9+5h;Aj+x(׮yn+o*(MXV6@>v5[\yzseUJB o2.y$a[R;ݚ*Pv1KL˅גMdyTZ5XW>fE9Bi\qS㓝# Rd1uN$7YW B(AI6TٯсFmgN xk|xG&3^puGJ*2n r@׈sH6&]9;rWIיBRk°݇{AMZ+O;9zj5\y`&cnr9"\yAqMz+>f9Iz ^s{55x\yA~jk`W'o~dT5b+ ϷVkW}sSVϷ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9E'qr|zkE<侾9E~M|yOVb˪;,F?.nw,J}sk墍?=W=^szs=W=^szs4HG1_+ܜ|+N%b?M{OoT:}*(pR:=<нt.Q1wC3̳w߷akB!@0-XaЅ.RI.,S,ASzԎr'>ԕQG p}a!ȃ̳Կei(`}"z]'Lc8gG=Y`kܟf[…L?_To4-Ǥp {̳׿?̷?(ϮKc_M{='so4s,eƽei+o5lzO h翰Y9{{~T F%RMq&_=9?79s2{^2ߴ} B#6~kc8gG=Y`kܟf[€v!xaOҜu~GS9Z>_~LՕjKO}JG{Wz^{{Wz^{}¨?̊͟=yuc{_O5ǁ hpNlA:*t&G-yk: ZD(DBA}*wnUB\̉ZEiz,_9%=)TD19P>oa!C̳ei(`? %Q/Kŷ$lzO h翰Y9{{~Pz* 'Lo?{='so4s,eƽei)Fum&_=9?79s2{^2ߴu[u5v3mI 9g=oro og@v;OmI 9g=oro A>=|U)t7kc8gG=Y`kܟf[ w!u*^3zk=͙'Ga1<RE)*H9 Dzw.ʘe-)!I;GGk[zc BP|)3|Wtd6=PWEPjډ\E0=yC$Wɭ{Wz^{{Wz^{i ҏbW2Wq?90WW~K%~C.5Xs=56m탞VKo=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^=5\y탞W}Mz+>{`禽o=s^Ϸ9Ezlעszk^ՠk[֮Va{ mۜl媵mo-oCY%n\aI6<5]3.9׍ӕp&a6o*MG{woECUTƆܕF2o#E@?j$tl0қ~>eTZåvS| x_x{ v;6хpdmMZv@!ۆFhTZ0,.ZMw^-}U<N<ڧ|QHF}O#0?V5IǫL_b/mo`ǃ ƛN#JRcԃ)T?*̓"ոm?14A74xv<2C =b|2r,:-'G\CCTpE E6Ѽ 8d 6)Cn(pFY~czZ>j@;hܦ`24~=)WVe=o{)WaDWhcl} `{^61&$|` !JRyiM] }AM Q#Q۹=-A-<k*FT$TX4+F* #7V㤤bcXmDUP,Àuj.q}O+"HkΈoTI< jgx\efYObdE0k=cAÊ 5ׅtj)`C׌k㒢0o-[mc񢀭ҀTV9H2x F=UuԐv:F#:# v.u_ij@n(ot=FN/R SkIw'mMn+9dTŤs7˞Ni`E~F1*#N\]ŹSu5 kk1 Y爵_X5"=9Iouރ^K^ktXiۉ&EB~q ccj+,D*y54*l*ηӒa4O(1o HGw1mĤҐ*# Xdr[NJgm2F謠INDp_RR?){ZܡT`Eay{*ܦW-1)5}:^3b~{m{exoD$.us^ǒ; & d)r+/@qイF? \}Aeo6.1lo{s{Wz^{{Wz^{Q?'Yu'lS)AER1y*k^1|<-}m*|LJ18OI5ݕvihMn/-݄.gR!5R#üE_¬ʿ{`dw?+ y C .=J=,z&|W89ͷ{*\{{YaLpsۛo/* 6U7+#üE_翷6_Ul1qoWf Gy3nm0Wb4sgA?WaDZi^/Y/=¯e_cҽ0^?;ɟ_{sm^ʿ{sk{Wz^{{Wz^{i ҏbW2Wq?90WW~K&~o߷igmH^̱WZu~"CCM߃ë+N\_W=^iyKs_=5qVMW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zkW{禽^9/{x缾zk֡B4לҮ#1H/ˊ[6i妩6=MR '_jk^ZJ><֫"r6oqy" jƜI 2+ʇk49ťsƘ=H zA.Kmf78y {oH$A4F̺n> )QIY%B. 6)2GSYB@Y$~Fl2q@Ǖ݈@>PYG}du`}pTOQW!˹7,ڒ~'䔔 'BPEypU;s ]߹P R}4%ÒSwCد_",n3gG;|ܕ Nޟ,6{hε->$r6?؝Dt1qζ]W5WnTv(틔\,0;i é"jC:}Ul<3uIŨLLWt2ck䙑*zG£,1hOQu6t"5 1rFX=ptX2Z>fMSUӬ径70dM>J# [$0Q.-S x L b]wK-{ xB^jDQebW1I±8RGn_Jj*j 93}V'Jb(*(`>:Si>ݒ"$ܶ5@\Ѷ$ʃ* rK kco$O*f+J2 }31Άyz ǫ2>۴pmO\f jXgbpY]M\Z䝄mC(D0H h;@cu 6#]<}M䚃P^kۦo 4M DjMsW{mHyS]j{6ԚFw'nռI1QRJTXmkV8\+7!5sZFӞ(/Ӟx^[Y+!=Hʶ{I׿5'H}MEl禽^s^s9Wʀ-}9DL/L8&QÎЫ3~T٬<#f+SVs_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^s_=5=^%6缾zkVGsy|ת3*_=5ؒǞV?;{禽]5_o=^5_o=^5_o=^5_o=^5_o=^-u缾zk^s$<מQ x1˯C&9INw#{7Jy HmG*,ϔ Z2R4=qcׁf$Cx/hhRΐ2C̉$2t^= k)bHT\ckR;mjm.>"5ecWGڶK]ʊ8F1:7n 0s);RJjU 7<x7DR̰H 4 p{"ӿȯN$`UPv*8Ck@D !wV+)Pn{ dڕ@exK"pn?8CK"jƂ""XlJ(rz0A:Qi6,n xGW(*Ib'ke(1A' gx]T!k ,u<籐rANʏUHa\ys\ys\xLʑ52XadR:R!ё{i.__$,jwF>-]q?]$kH6eG^N)R^EΖɔ48$DĘ߿~0yOaZLV :~QRњWQ?z#phHM$NU޸508БSEMCW_vE=ys\ys\ys\x7Zw#<('F(y7Vwv cP_j_BMbi@Ot>Xw~74cM3FXBjⱱ:*9BjW6~FÉ)Zn2ik o3aӍx |9IDok}U5Q,I=N` /bOÉ1R£n7k }H뱊i/O.HY](C*lEG4b*mab.so+_Z>M䌍dev\)>%cT;æG_IezdXh }q|ORbX i$Ax0^9Qx']o7ߣk]3 UIfm,|x8e zjG7O%9j>c qP@۩Ff#Jy[Iitӷ{b}ZM"pbSģ|9%6SxU{k`izq0*ݼ9#r+yȋh9ቯזEs }kq^&z+>vۚp ̈5sP\ya榯o<ߚߙ*Mls0o9l{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^#{zkM$ ߞyE'k1O+퇞RZ1*[zkLSb=^m8?l<ע<_zk^/>{a禽zk^/>{a禽zkLsS=Mz(9Z7l<עS2rkǚ]?wu^vuox넝YwoA2:S7 ~H(W5^{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^晟?۝$F3Ps$'kN-c絛rWƤ0g\S.|j-e·t\& lQ$HfL(8wv@SSR#"fUO{9퇞QDK{l<ע]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^=5]_=^pW:{a禽MW퇞R>{a禽w?=^{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷyEzl<עszk^=5\y퇞W}Mz+>{a禽o=^ϷСins>a[[Z禽#JXssTaU7Ueۿ:6c7]B !˃T"kr«\fxyPGbAw:{qi⹤R,g}pRO1T("~dmY~lHpc3@Z b VO3(`;ٔq\L >f4"G"7 2\Hk9af)%e;F )\vqХM$P -JbsYitьSo=^ W03KRXx9WQKBI襖Pyvཉ6 jFwsr|.>M]OZ!jF$E!16;UTX}}C< `xׅymx'eN5SaAGǁ; HbiNdC{l)'L,Mݻ{t0ҲxCV:0xidm v=QP5On+'=^=^=^qS2]F>_:8\UTc0)7G*co[ʛtqXƯ8 ?J}CűUå%p<XZRIKފM,Jt*٧G)ܸMa|; J'N pSR4Sw1a悩 ȡg4&&9餉bYeXiOhecHPP %kVԟh;B*T(8OL"hHoQr3F)I8F4, 8 "&JC =Ou<;I{xՋGG:JJT?HGjNF?k#Nh=\D0*G(Vg+3GTO'9c{k}>0οHZ w{iea/?KOQFTG6 ;ExT6W$6088dmk̥v؋x*idPU֋Ji]KYe03{G~f.?_(u&´Fd` K⩌oMnuH'6b-TaM3bxu( ZRÜ1z O)FF} [a>AU}0 A\WI: W?'+p 2]]##m8֌xOXt6a7cYJӉҙY%ns`9}$z׾;`t :f =&+0#^ʣ<{Hqs*/>RqΌ~GԹ2buȴH#At*~-Pp:ӦF5ƎjVp6N kBM*"e'plQ$TK1сXJ4,in pNT1>< ")Q`9 "CƠSX@BsI梷5<&u㝅<ӀVqMkq\wdyIE{xaO55`+97榮t2*T^^SWm<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עd^{i禽S0T綞zkHKXվ{i禽ya'綞zk@5&>=^ q.Fs9RVȤyEB=QO ?1m<ע: ~cyE{/Y{i禽g9W΂ş綞zkLSo!P5:1_{<~Mz(MUE'sO=5襬}P]綞zk\΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyE{/Y{i禽g9W΂ş綞zk^: ~cyEvQ[=^sb=^XaBBsO=5CI-ϞyE .<% fMz(JYR PMz*^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+=^m<עsO=5oMz+?Ѣ Ը1?Jdòn>}-GtYoɩf{o}GK+UHVǦ6 NâbHd {׵[:S$E0J}A*I1Ӷ~UP 2g [#\9)O}#nຂKvQr{jb] #U K kn@[~| 92# [p‘9ܩ ߊ8^yO"aü } QڱiNL|\:0-\l~ֱP J~ņ4h=<$6ﶤ{OOqG>b+kW.)~x}qIY*+ [~em^v{y{ sxְ ~'#+Z^/iX:D7KJCj>Q^(a}aoυܡ:o0WeV8+[s#k%67Y#_2Jz,G:kOr@{VG|AKZ_$>/ 4&? l vV'B@'sW5lb75ӌהV\ 6=)6_z :q䤉)(R#кȪ}G~D2HG [m@#)3ߍdu%J,9*)`ibyR6X_n;`&k[dH&'hq#ʨ,ˇ4czܛArP'ΤH6PcSRi[[\XDJM͇cNJzq|SS r>oǓj(KWrt8` 8H1TO+èXŏ<]WMX4T}݄МQ"xid'm޲f4T3 \1 y"j:P@"ǎT1븑ĪlVRAc1m&kN1K[iJF!Em;RbXFÐRr_S>wxBLI)Eg+@n>AykcqS̄X4e;G_JCIuvg<8p0e)=lOQE0iT₊XSho \C='FHSh21 r5W=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss]Ǟ=^deڤ{=nzf*-X sNd2fXs?! uRa6F M͠q-#-A lF׸D,~)=g&~z{̕87M͉ Mu*<2 UBHyPXv<_W9j;ǒ&OS&unl!a^" %DIƽe־ӖA\3&Zi8ʩChEP^I[*)km`H9z+TiY͵8H6H)},|إ>5c-Mu$Hf20APA2u,F^^S (Z )*A½ŏQ]{{Wz^Fap쯀WflaRaUNK(drjHPt\!#i1L2mQ dr})~*i2ntq('Ğ**<2ENt X*7|tHZTuHv$^PM{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{CG<:f:s0hp#XidGLhĥЋ:Ӄٻ Lu=:VEM JTj!0U5+)~.}bfz9/4CS9w'drOYjuO$|GE{َs͗Zڶ$:ܳ*szs=W3';sdswd uc%loU\/Θf9V̹I4ԱLnf6 B;f.ҢtI)~T#mݬ+ [4! t*JT`bI;MkK!>5VNYj8vFI6PZ_1E44KiGQPw9eu_L5Id }29ѯbi習ƑW|/.G)z/,1zmA 9ѯbi習ƑW|/.B^= =3]K4s3_ %#(^&] 'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] Ğs_1E4m?HJ+_ɗ¯'vykG=c:5`Q<[O?Ҋ9eIݞZ=/΍/_O=4{9{w*z?gK4s3_ %#(^&] /Hkzi){tk|/y䶟s/˿TzONrلF$6dD2쬤-\QH;:{s ˭oVۗZpJЕ%@P$p ӞZmLRT`zz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^=nzzz+Wss^W[E{=^?ҢpȮm_vբ߭,*Ac~;MVar5jhخ-slu$q6k"nBuQi+:04J繽2xaTsƇhH,[&?aT4_E|-XB,yǏSQYY(abi!*BFfJOpƵ Oŏ h){s ^GK*^q;}!^%lPsOnLY0hXYAk Xt>QvJ9 lGxD=^yW=cWzX1Q hKwm"bzsWBWOX4DlӅǒUFBvyW=cW=uݶ{m ޘˏ&H۷'थn׿6yo,l7\[HH 맿=?X6Af-k|? `X{W=*ňíE=88V4[7:*Syʮ`vh/U⥄8 ٢RUIV56 nT[QÏ+%2mz8"oiJ?vR;R>Ѷ5Dunځߌv9*Q%Jg,KcZ* NHT Ӱ7{GqJj:zq+m[m`<TCi* ' L\[ IJZJjyg%J |;cl[IPyL^:Y>p/lL %65l?B.7C{wmw:b&/2Tny݀{-č90bFȘ:~;j5N[}GVc^,j"#,S Nm=TFI83}HS rY:;$ar=ʊxav8OR*xJiܾP;8 UUj c%IБ``6R^w!_qL/&\F 9w:'evզ(Ab[ypJ;Ğ`[쪛[k;gYi#RcÜlROߎ348R_w^.|-uAiJ[ߋ=TjPAe{@8n2GIF!QV0`N]3UJQ55Whĝ-h6Mf#y8^eIءQa̠r{rB٫Epbm~JXiH:ۉ"MG1:5௓:lZ,iu*p&60ʩ eR ܀4x o:T[7"(5rz6Ni6WHk(Vբ<+4y&GO4Ȥ)ЂxVjs;QTho?ݑ°&9$Gpہ -oɟ5PgQ"*9BkF$6爑]$ srIq $;,Q饼x yz T.A0=& IR_ci<ܗQJymzAAe9FY75A٫XB{ƍ:c&#N"d_ҷx~6Qҁs 9S^E-Zp ý&B%6_8ʏE8ƸH%5< >uOz)VQ.ke!tc>Z3Q-'N6Fg߉(WӠW,ucWf!5yE~8(׉(Ȁ۹梵\u^i=5Zuο(j I:nnjXK0609Z09Zp ոongEcJs ]G+OEcͷע.\ ۹/=WneUӔ^^Z+ۜV9`nc巚E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syW=E{{syWEǞWX)m@FmhbO|?gm/%^vGKŸW@_ŏ 3s<ϭ9z^{{Wz^{{RG0osz/R~{UXuAѳ79~{ ! F8)8HB*=W=^sz_1oa"+OgL?OF?OUn߿冟o7(=^szs=W=^szs=W=^szs=W=^szs=W=^szsar^͙i0.zb2#XdE$xq IiS .ii*Q H$ʬutW|^aϕ>&Z/[PȴNV;F6Ǚ﹕[׏JHÆf?z{3챻뎄wI QԡT`HL[g#j=W=^szs=W%]qM^֌1ph'᫬t~1M2 kA{tJUXK[#?- JP =R=kY郥]Un G1L: Û`3G-El곫/-]8י~H & gosZjm* ZPBP0Lep>=n9㠔xFO2RTrH6i7%+KVS'IGTخ|3zK~"ԐBTLP|08Wϣk^f36X*(54QK;(i #G11`Z8v%j}ˑfW6<*V@&jWz^{h¥bUzC=-54$iӡ&߷.Ro1>Fgkeڭ~Rg U'-ۑc^}s?9;@=^/kszszs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^q ֙N%̿g?_ײyϳ_'r6~@yEj1gS[w=E\TIsyP͆Y@=E=on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^on{o=^Ӣ [ŮEm]w Mn+y9`kDMrܼ~: 2Ef9 MϹ0ӗB+ +/roi=ċXiqTcmdZ}xuYK M-Ioh F]ŬA<|._*bcx6;MV^(1qBO[1Q>tن'ʋ)ϞW9QSNZĶҷiVcn ;G hm\%nm!&UQ#Hͺ;]@MG VTPV$mmw^FTƂL2 MmEK*M6ӵb;k\<J`'0?I"9u\RbG P2+ t>YY#DRIP6n-{7 w\Aq 1V0XrCuHÍ=n`lw[mc/*;ۥp^@h ɑ)eCjWx ܱ ^ڞi|Y@ɕ0VBYkZ RUԕ'X"BR3r#䔀MWTTTSihj\*"SSVN.UTn}zpzx{rD<8 SiKg:xk˙ ᕴbᢊK{/5/ iWV'dbN')Qb5db`;؋{AFڑ<*yHo?ÞZ1#>$_s^W\@K1 O GKNUc6`I .,Hf-c*`7h x]5f(UI.unn^{y{m77^ǝ=5Gn%~Z *H:qdrTzh$tSVhqhjXc8R˕2Y)UtMC)Q(k|V+_tR$yXX'WzF ȥ$rj܈UX84HIdPt:DK`Lg TTH1$LXrkK#0SUbІWwGPVA>@gm=rAlX\CG+خK\;~}UV).'Iyڀ}{Bu1KYXmѭ$6 .=߫N9))#p{> oh=U] ƸpO;RV{ r~ bm ؊}[ ﲀ6tI;iC,0ʋ_EF719+]-69G4 3Q:wl)(<'.%$u9 6Z@QtE2ᯌQT!I:C_QcUbD$E{"_/2s)LB^M`F$tR:|:R1ڏb/ג(禪O1U4%i(/bI!]X~neRmw.Eڿ!~>e[&GC< aI!|Bkăcog?h M2s#JKP2C)`~w)ISLZmung&ݸ(ç i)٥;_/]KVy$Wy78n!O@8(qqy4OGT*cr\Mǀ[rn9Ō"eH#t7+M`sO"W '63MU= ! }H-[8Gv}ܲ[~<(AĐ^Rȯ=["3cXu=$i%0>yF.aqx'aRTAC qzXvc?iэ!$ pE^{8`ĔTQR i5܍n–HzJ)B@Ye!YwxY %j|lk*}.4T)M`9Jy%>lPn̒](s{)N׍$ 4R0XJw{ız3-EKom5[,H+0h"1K((Տp`n#-\Ӽ.l{uhM5GH"{{{.USUf^~&AZ|;iUgx/4'`ۏxWRF&݃o-CJ/*2[$c:m_*fl6ažd]&[7V>=i81ATlB-3Չ}x<=**C.i)z7V x pq@hg =ni+`;*4W`E3Z2(iȮe"?K}\Kzil u8#vop1h9FAAȅAxF `K"|nƼM4WWx9v[i*hڦ)b><¸%"dFW3J{K\>hOB:6 +Ps$ԪQEpap|8TGN0L" iS6Nlb/~g s[o^,rjdq^:FGLkVS7^Ә8)Իh)1ں|̄xiôH"Zb@y(@W= 4\Va]G84lxLI<=(u>*u䀣o^fUWE{9I%N6MX zEFn7ƟRL9naju 4E&0Hv; [+hM 0D _g Qj~s?ǟ6UxJ/|Kg#|7of5wܲ?0@O k1&*zr`F*蠸7yN d<:P۳̮wEҮIR@H$L *7~/_BF/@Z>W ])+g)yBJ3%«R,@ r7m,a<"cUnr,7 5!@vBƽͅ}z_~ayCI5KK]C9_> zIeea" -s*t#am`ު }APA&cFr'?I$_k?O؏^zǺ͋Y,Wa8>Gq-v%W]CƤ#366RYʩ=NhZ$kJ<rLUvZ[Hy+qlCiC'hH@=fOijDz/e"C8>7ML\!6Wh=˥Dq J=`t4'gL^-ŧ8˩ (Hàk86g޸RU3VQO(k" f Hށ\h܃3,̭ӛF #¹߽{sF)PVI0A r/?G[J2K,,WQMĄ rx;FrҜRaZ`xײ7˗^[e)*O^t'u}]M}2Qϙ<'6,=m$U-X{u r4gϑ"C9e2qmvrj9Ld,3q#%AEXbD( mPTkPO~KYf"\HQ$|4K}ɑ-JKvbL}k+ٺ t2*k*L+b,2F.@vP !l g4!*ImK"1Jm6Nܾe_QpODaрEțg=yv6@2IL HЀ1ƽuPS'Ӯ'p3ZʪLC)#-Qhi{W<7J+|$z*[+bԩҔ AtH&͂}F+Agܦ{ű$Xڒzhj4PJDn욷"!dn. xD'`ȌI'!^e/k. AԐʇ4EC{E͘߇_CpO,`Oi15DjщfJXFF,2j-H(Lңffd괁-.7 p n,5gX*(ʋS5TP)j)3OUy*Uf `ApµDvzp'ڌ/wI$RRҭI@`p~'~Kur^K*<>k%(dX-5_#SܨL=F1.M+R@&S M{?Éz/ú[:%SlHuF1 L$O}5C 0ўE[ G%Nn-SlEʢUov"j'smn[n'3h*`_aY>mj\.֥beCҘT^DJtʰW`9)rH$mtt:Q{]ibs5n\\mE*cic;gRsvڗ38GMtW}o}mqnE!S RtZ?3'f75tfO_ƺ,|' ZdiU)iE@JJR3۰v*NPm+)Dm==*;. Ik̍+ܪLnpw\W]oʘ.Uz,QcVUI$0വ5\m #K֔)ZL J:],E囮:념R/))Fշۅ{{_Ry_=;tL%ZbVbUjϲ2IW QI-ţT}mK\܆ܼj%0=2eN](JzHR'lho:V$2d$/^]æV┵(5T4}9PC 1abɧX+Ug %RwJҁĒz묕־& T JP0qQ0' {'ӎVzo&VXJSWRT(ފ9e8S ~f] }87kwryEc'@]U' `qг6&sץ޶ u"d54*l*)*7 4deqC^XeͣaG9ۅ`ޮ5&PV=GA^?ٽ^=7w?]t?ku]?f_$b|w/s$O%Z?NN[#*4$_Þ~rw9zC_d{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^+ISeegA #dew(&`%M7=עOOw=עl-mzkOמ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyMz+מ=עyԣ ksk[Tszb;k~܍*f%~A`GozVakj C/iIQ *AK.b^L- HΛ}2aB倸?r7Up\jEJ؎Z Vyf7om.gjL,IxD@g*h#=v}t.H3U•x m #N1()>5vcJW#S_i~w wkQ?*>>sB.! Hl.oov HkA)U¬|=coQKh$ 6MX&?MUezl:2TK8ò~b(Eu ( 21?ӟƙƛ.tEQ]U5-MLP>bm\:p]gf p=υo/L6BoƖ. <hdR4{l ĥ N'Lcvۇ.<WTN)Ou5uDZ*IX~ύD&kߣߧExݺT G|)$@ O ŇP$~>I-ExeY$;naѕ> ;1{+y,< <jJf! ~ñ%S|PW͊x` ~*f =Ju$pTaq _MaK >jgÉrT3\t?ZđӅ-hrM5TrW ͔{5 ١N! dR9CMQ| I܃&ǑIAw8y{=Us5[sn2J\^QĚ<g0g0<Cv6nGknV;FÏ* 7-Z  5CHvn7nCaJ2y‰ p" 18ҁj%J_[ˋ*NTHa{/4z<|Q2+WVl940lnbA#,4'M* 5& Z䃧ksX٨SF{0&x|d5s7:QAˍ4AӜ/ ࣖDGBxQnP*hhBIXsEm\Y" .ZZ4 v`_Fl0"9BJI̙ 4$ rl=qһ&MaK֎1c{Yt?$n4d${OK\.*>TJ\u)$#[Yi2~U Z4kk*^b~4jUՈ*Tن=0N01)5MD'i2m3! )M8]fJZDH7}:Qʮn<>Սfs*%;< -20_9C)]'KZqhZW +u[ooIDfjEqG1:5}»րҡя,>$=V9G*#䦖$,ipF#G(8A )`j%$[*2׋<XqSA m;k+U1;FGISA̧|`Nbo?a厪7 Xҕ(:kT$(ttr* *4,55.'XUB0ڰ,or FgtuyѫhWF==~TGLfCE= {Nh)$*n7:.9Z-ceywA0sqGKLίX{{iRb?vL rijҪL̲S6걸 {j ~4%v;vr:B='|xTmuVfurM;ʻuog^4vq$l5U66Hikq_"]#Gѥ3'mԨNf^1wАx:~GU!1en̲bȚf,L @e1HS+J{xr>5PS8d2ay(4]s:nj±O~fU6NJ^IXG4-"+iAˆ~O>Εsv{H89M\ $54OߙQn@(M:p䧌-4Ea ƚ<-qx# ny(:l~ykmx]T68~Á'Whi]hGGef{򪯴qaQD&6KBXphʛc̪ @ΨqjW#@q3K@M<q+{ȪLgYcsmskƻ/,4جu.Fnд%etЍ%J%*zkMV?"jTXġ]A1OK%E4~C:$|G1*yV-& =F}Ϳw,ͭ^dƒ͏0$z{xg8 \dfc?类}@oSv<Eջt:n⏍cӿ]sҟ^ٴpOSŧT*0^՟MzUz-^/|RDAH˄Ҭ2r H`Geloc?/[xbD1Wgԑ]+ݛvYCŀTJFU  da {}q6s~ 3พ|"`zg7'خ!Jj!=Ѽu -`G؞{޳t;\T "8p\Su/}F|> ñПv9j $ʕ寳 `6J}t{Lː{[J N)11srnc}r_1oa"+ѣ쩞?q|HsebU5EB%ai$MyMYLjX ]<%@u!q:V% e{J~4^2_?1IqLA6f* $j*|R, ~Z ݫY" :Հ5ή2Sʒ핽$:['UoG_)#"]kqe4k, m׹w~Oy_bgn!QUhs_?Ype1?es+=^Y*ji Uiw1:ÉXJnZ#h~|MXO[H3SvXaW}=<70BX،Kӗک}jOAV:kgݜ˦0xj P!!Q+zz=5f<;&`Ul J2qLաl{\1:BVN8=8^6)v;V &HPN5hf%?-]S 2EE6|l6W>s̤+.@|lqVzTN$z)?Xrc$c= $U#ᒺYiIG0}~.:qiÊVTZ5 MyG8%n]'K8)݃&>6kG}WC>-[U5ҀxR W5T_|/+t6 P N5b7m II؃Ckbmƴ S=q?*}I}I(M:0מ1J,Er5zVٸ|s<tTղ5HAQ^ .@.')W K=55DD$Eo2Չ*(Rwn%j֩RVRN?i^O-_^^vY 97*a z]Y:䊚$XgP?_P4=1zsf]_MN.G$^gፎ6!т(zL]k{-Xq)'`Z}O:+9ㅒzSUS&CfZx8aFrc@ 42=U•so$TgQOj}:i$&1-'gñn+u+2=3 eV 8aR5ksB13^ͷ*~TW֧8+\s=V7%-,N I L$h#a57拙k~Y ''2'l][-S-(TG|@$ }l^zx/S~3AN $%}hQL+بcInKvQP&f8XWݍg[bq*T8(Xr 5Φ/V5S# MvG+jٺU>|I>=hC-.FGI^?ٽ^=Uci7t?ku]?f_$b|w/s$O%Z?NN[#*4$_Þ~rw9zC_d{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^#k3獵n>;[_PYǿnP~զLso<禽CH}禽J{`s^s{=׫禽^g=5={9WMzlzk{`s^s{=׫禽^g=5={9WMzlzk{`s^s{=׫禽^g=5={9WMzlzk{`s^s{=׫禽^g=5={9WMzlzk{`s^s{=׫禽^g=5={9WMzգbӜVdyE{82Xr֫'$U$9`j)kȯӎLY}y#h,Gf-qv;p} M4HU:xp/m)s)q DB$*2Uktj˹V|BpФ&c⟅ݫ1%iY"~ Ӭ8+-4ԨwsfJ}SAo0~ rTGFUv$y$SaPIdJ}׷IW#9{}ËDR1Q1S.(=;SR͙m IQRƪ'y kN_:_~dų:=kwc{R nS'? ]K ZUTX F/龜_e-IX[hv6ѹpc>*ZICWG&)%zyRY(i^_l-%xĨqnq9U4X[m8ݺa,u.+"zi֒iܐ sX 7s^oOW6)'g3C)H9oc*Q'gL rXlܭ[=Bv&+'_1|>*Rƣ${9f\R2EU r`YbEmD49Y *B`n3:S.A\F.^-$*IV#ۭ,ph7|ŕ(j n#Ò%vl&4Lm ^5QS[mVoa8}-Բ@ƏSp/eҰ`c}.)"@"qR t\#2m-y,c4cts BE+):4a{XǕ`dZ.$vW ^w$(Al.5@fxvGW0O9իc}9z]݆h̓Z"k;ESKG[n]X8y_zR/Sa6bm6R89lKn,>ʅ4I6{i\S BQsk[Øpg܇k7XB m֞'Yjhj ,;*EX4b kkx&v8b6R fbZ)TyLk [ N=t¯P¥8b:Dx%mu0J*3 x:ؒ/qxfe}e;N/oZ6|(ރߍ?Wa &XDZDja@ø78ckmo0MTVxQ4җ"ȭH 4]5S.1>'"hj3OѫD0{sE5^$fUה&bf#3i\ ߙ\xqK/#}'er#s55\w73_NEbrGneT4{r@A$hCHajOI9TmxKBjlSks@oYS\|8h%.Mry }\}šjD5G}{)1 \cA"xG2݇ p4Ri|T̡+4,XKsR$)$! <,[? ~lkH dsJZ۳߷0)/3MVP"~sT[s{y _:_ o5s=W=^szs=W=^sz9}QzFOzîg̓_9R3RYi Y],zL;/7Ӆ㞉:ł`MfG͐BL&$sr]4O+Y֭|&i ̘n1\[%PӃç(?R;#7V#Ҩ|kP6w&mcb.OP-=k[7QX71+{- ^斟8;F-,3/lOꫬ_Po[ݯr?Q_n1([mX\Wn<C=SǷ/x{~k#`nG\,O|Cq:h)ޭjdՑUbr{V [D P :Cmn٩IVJJT Q$4I=S^wfPk ~bg++,js?Y]d>KxL2v*#e i(=zx7lMGnԡI'.$\<kR;$]{Pr_1oa"+w+WD&$O`}Uu XJ?'S%: KauI9ei*hW-7A;Z%;M14`8%`SnMWZ>$R}r@T9찛@:V> v[PWD8I禽ŷ)#"]kqe4Q, m׹w~Oy_bgn!QUhߍlx0I[}WUP+ˮv^#tZ{Guc]S15>c\[˿OsF/M: g*yUva+_\bsRQj;Atۂ-ِJK# * {c q*S6ub&2b(rSUÉ>?YUܶ6׹~A#uw'HԽ<ʘLg æZ8c+Y5>Ē׾{QcH08dX]gWlaRph@T "Ȟ%FH[Ux` [q>w3?W[6.l_ˌ\\%| O '%_5[!ߟԝ-+Og8?_)_IQ_Ngz4(;;uI?Hl?WTiIH7ʖZa )X:&I:$Tonsʳ2^SdO:5 CT u$HD([Q?̿GP ]ysʴuf r|I䯼 ' J}Vgvp " ih<+gʦ?}/J}5D).[ ICUfK{7~OB?DjX?z.~)5=nzgLlɘ:u FT̰| K/y;NRU7ݶ R?*PM 7U y\;oUw;=U Rpg\*Q_RњeްQ۱4J~8\V[FOM3kI<TOsafR!Rm m'}T?n8 I+-4r0.?R"ǑF'[F7^n}I^ă:kR6VSIM=0kkL~K8Z0O32TBd.2hn \bJG!jJSOwG?&cEPi-zr ,71m>Em|La$mPv 3ᕰN̖Ao8Vc颦&R})/|Hjؒivfʖ,+ Cy>^t<c}7u!6lSF`sz}[?;jk˹osKHm'5?p[gex֢g پ:}V5VQ򶡌I"/w၏ʖ]ؒ#PQ_y:*z%s`mxR 8z)C`)@ IGy"[*($GT &fb4 %IWd+P; sDF>YF؃U2+zWj4 }<4<(/[* ZH*j@#cW,5>P "5o}x褽 qHF]~e˙lT1 3Xk5n WZ>LNP_ܬ@?:M⸰"'}!cýurR^JtP}H Ԑ}40TMp'ɶzkKRm^nOpΎazHVkKx!ı#,xj%)8ޕ;!C\ gOk{=EBLзp*&&)AXċ؎ #> (*=׵+;(o\k-48gR. ދB-{3cȢhP0JSb"ccb}NZ> M <0ҫ,Ը2Ш؍\S'5YTl-nܑ$nT 3 V ;U`IVM+2c2Xlkۧ$(QƄp[{9 \t~(ȸ7P-M0n4`IL5f݈?*\F>Ca ^RHj|4T\OyKT6Q)k+-]A;2 a٭nM߿ T|]*k%w_ӆ{:l6:ZiҴA]2Sp1kPM!%<0U5zRz)k0r+k߯ǀIʣscb9xLV@ S3s`v<,+2ݭ~i*NÑ&[;Gj@K~y̏)m!.#۲}my. j"zf_0sk-DbqBD5Ԙ?.I&⊇j358vqO8=#㶌o~)j r{{mmc-/LVg`lB78:H'RNE4iE\^Z&(-M"L >cr <(d%"zvTd=arjjwSD%n-fS@‚Vz]'|&(9NfV]Ol Oqc۔vNTv'j-<6bcUbUX3L!u֧vTOO*\0^>8[SE9BLcᖯr4("A$Alb00/8=vn(‹Ĉ$âChcMaV0EUݚ׽3*_Goġ5 ^TZ"*B`~񕥞Ԓ,Ԧy 'Ŷ/խ4ӥ۷Xa$TGTUe]7658P H)jN>4 <)Ĥ] +WyT{5`5r9NX wZGޝ-,lSۦ&Eջt:n⏍@NuJ{f?wOS÷/x{6֥oCSI-`qj@Pc /43-Hi d̛[HNFnY&[^R [j6JURSWAơ>n5B^Qzx6mu[:wy?y^CɷRtD:|ՍY'-u2IZJP?=kܸÛt0W8Upf\>YNPˬF"!Av#(9:PQ) 썾DV,+qJl-ZpЩ )QV8r8>m~3\уPEU^C H.$*"@mI>4yZR ' >zS;ᵸ#e43I% SQULjd`άE˗Z !AC0;8vǵ}ڹL-e\R]Cj-! OD铬$e{~4돧Iq ۊggq(*_5])Ҧ(枢BPF7o wwiW ' nXe=̳d*B ITE$)@bgPD׸}÷60N+ K,2K-,*$iYFÁ=:є"q'iC`; Co[x{EjbP FRxB=zoθ)}U`T4SeVXв?5M ,T1kԀr`uS|ZԠ!J)ғ`'z4t;JC=d&8 #$Bکk]+n{7Jq$!dgcG\S;um9sliaTNK B$6(֖S_L}^eޭzY=DžV}|EDdx"D(ASiu6ډlR}vbnͦambvTνH+RL^?L}]7:߅{1lտ(c?UC̥_ ?^{j“`,zzqa4qKy]xrUҺ퐅T]1)I*p6U;2ɻrD q@U:!^e8m&Vf.G^+p(yRԅTx/ _{uⅭ>pB,%L>d)WD׹G}Aq>S3P=JDUQF/3PV"&1yݕYUY r#]r$Z :g`!J u fY~)'K(_}=wMYG4j 5iYR9QFyj 8Sip mS4m7nZY Qؕ(Q*N׹=߇! RҲ.!5dH* ׻\<ϼ3h#&8pâ3Ӵѿ7Ko*'uAT6!?ПT2gN|_cx NEGUHĄnC{ yՠiq1lfk9fw2_e% PNT)H *8a^f͟qn\%| v!O _;k(~֟n~'#Rw??w>՜dOUoM&yF9v ǎxU_i?:v-*|s ͙+K)c★>SA ⾒ Z8xj@(w()%*mI2P2 @2:V`92峭hAp,Q Rr=`}BMOQyo|/t1Q QK  T4)vw 1YC3Z2Cˤ]fuatf$x ZuM#E$R#{5 b2NĐ}AFn]neд)*(JA%0$ 0!o>fqdq, u~?su} yú4R/dہzBĠWuU+SN|~dn*eF伕کjVdyGv/ ֞a$km0J?5ZTӕMa-ּI`qa0/3TʴC3Bir⻒H:xuMcf]W~HE .-°{$~@D:OAr6+ɽ$$ys5+RaJz2#lŸ@WdVhwtda.).||g"'ၜ>9n\%GbBw^F 2_:AQQ&iYRjĉ(M䅼rkAdv 'Zɾw]+kʩeJ$&&`{_,Sx1JS:-48F!EAH%DjJPGdVv7u^?"`2bzz'gYod!ZAH;$N`,=1z-3u2L7"qI:  IkBʡ`Gۘ&J L&dұkxs`ݺGwb%d `4$E{~,~:xzL⨡X9d8:^*J?ν 1\I{f[-{PNFރY٦ZN,nSoyqR#@XBF}ˤ)ӕN[NMnkZफV%;T,^ap/o5~F[YVǠV'O|E>+HV(;t\g늋E+ۅeL z͟F^\#3$_Þ~rw9zC_d{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^+Zmw ~3k}5;YO>Wyާ=r`?MڟO缾zkGk'2Is_=5 uy|עמE{z_=5o^{禽y|עy/W=^缾zk^޼Mz+מE{z_=5o^{禽y|עy/W=^缾zk^޼Mz+מE{z_=5o^{禽y|עy/W=^缾zk^޼Mz+מE{z_=5o^{禽y|עy/W=^缾zk^޼Mz+מE{z_=5o^{禽y|עy/W=^缾zk^޼ק2i)Nr{_uCS?m?D'Dx-"V}ÍJ|Ӂbz9;sbX.`_qp;orǛMO"r H _+nAw$W)j}x\M'pr,?98b3S`5'_S ^K^z )Y7ی3ިw,W (W WNQ1v%?H]etto!#`sXlE_[ٞrh6?Z'Įxѕ)6ZyͮEn'\z u-!GsspƋ-E t0q*Wp)'5I}2H hGtnM80"'$7 Y0uziJXQbm>&=a;^RP<$5ki~ m^AAw-Cn1R ñ:c/\$[X{|DaZyUk)mƺXpMze6H({="Pab >v`%REc(< 8$J6 v;m /i}~KTbUOzQu[&'s/bhhi< Q"jݵ׸.)SГOGTznxRPc~U·&mcsy#b kDbi.1mֶ džx8tE)d5DNCQ!奈sQ}ǒ1 L1fK^p/2GOO!GXfᦦP^),+ޭDѽ hfW y8GdۡcޚhX ]kwcrO1:,31:Uʫ+, E~ڏoSxF8H1<1zy9 S"Q{k|j1+fj2C$"cOaʡn 6~n2PdҸCM[FjWdxt"ͦ${(wQ8&Nwm*)1D$c3Af3:# _ǎSʗ*E*Q8۱ȏ ɷ&,l4eN:Mb&:r+J-b.w-Es(v9zoyۧ1u6Ok@F^&M=<+R]u$W3ӄ'w#m]t#bvNfpzypIY^nRbM4E>Bî0 Ƹ׺URDF[{Ogu8O#;4:؞ hd Sw{JTh,"çu'ͅȹ+J!c϶wa8ssХ+ZXԆGS7%E'v` w7@׿2Vt ~tutÆ%t6ȫ6 47'zxRr]}li:Q;F4pOt('ml$etGs.y:Ո7F1U4WEr{Sۼx;xaX" :$d}齏DwD Q1:iɽbc P# )ZH8Ӽ qH䧙]rą Mv̲!p*>ېx^"Q¾fѨm8ZUMȎpBM^僳Z-Gy*wVnzk^g=5sWMz+禽{as^=9E{}עl>zk^g=5sWMz+禽{as^=9E{}עl>zk^g=5讏cl>zkIc|yMz(矰_1 G)**,ߡ /Q]<;* ʨ|s?ǟ6UxJ/|Kg#|7of5wܲ?0@O %WFBA4n, ,BH#aJX}v6$RI1WO7?dn;OOS%rO.UhJзG;|}jQ0d۽vDV|CDbxLpgG?Mdǣ]^ZXP%2VcuBŒΐP՝Pl c7 -ia* OLAK ʑ:_)T̸.%e $5#̛zfXإB'NARJ#3]n[tW$~i[RPS @T2M{lG$gK 0 uL"LQڢDd +.H1jCo}>-̲{.Jd8O-uS>ҮWi2G)X/ne-r:7'χ\59wvS \Hs[@WK:s Ν` W cMS3zFo9NP y1RSyFskr6&u$OW,/ߧOLT7@r^" >}Emo_|etIy Y_^[lԢ@?h]4VĹ' -CFb0VһFgG0I]^#e۫Sj)= }s-HR#{/FT]8.PϞphO6H#]7M;te)Dl*$iVc uǔԲD'sT:/`e޴e<7 iq.94bh⫎DY3."'bS)$)$eٵP壮2 %$$$W;=,Grɽ#˘^VGP}= 0KoAJ͵}˕jqEGD4eq8WjqJZlLk-^<=6K ƪ|DTN⨖3[KXN:.D,cxQqrڵ:I4 kպ-EF:P½;h=^ CPvՏv$@9iOݪ46F;vdZ//>8RJOY2M{&^?(:aԦ-I0+ywy-\p,Gۘ5Χ nF8T#&(LWL]ۧ) D %Z`@ WaO@zt'^2ȽpnjwVuI KpZ)$BEᅵӶjҊOH1Ig7yi{% )$t:z"GOp\LVѩj1U.C>#N../:(tes!8 뉯qYU:o ڵct)@ga&E#K 40vƋYLݏʷrZ:ޕN+L*L&v׸"u 8X$[/ṟhZ Z WhL z͟F^\#3$_Þ~rw9zC_d{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^/:uw ~f+k}5;YO>Wyں=rg95EiqO=9E|M>{as^cg=5=9E{}עl>zk^g=5sWMz+禽{as^=9E{}עl>zk^g=5sWMz+禽{as^=9E{}עl>zk^g=5sWMz+禽{as^=9E{}עl>zk^g=5sWMz+禽{as^=9E{}עl>zk^g=5sWMz+禽Х U`qX쮦+qx(S\I7 ҥk葶 HmZ^ۭ۾ +8UX @ J{UsXs2dY=l( Ev!KSPxپi '1N @pN52 v$@]n,2mHD)"}_O3[XTp$q))lȌ@;ƦSѶ'O=V 9ζwaЀ>sfLVOq ȹ&vVt2-ҮMdl>5)ۻFk~/l f<؄O}f)*X91*n܋y1LK(Y얱MǍQn T|?ʮ^]3}6Gα%.=AR2^G$>YjzŎ8]w_g"i#8aʝ6*dbLbSYHNn|ĚRDg*P\,<<~S |[a$vzqkpх532{kC kcWiS@-:ǁ:E$7&g,hPWN:)H\ETW6p> <P) Ĩf edcS qcZ1B*G "'률0Yy ,͹'g2X ^A}@؝P":i{v43M8{AmN'&zUIF[Z:qƌPrO5DWB$%X) TX~><8oDARQ`:_Gpb/e`Ekv᪙JQZ]RvszJìglA>EBH&'BIFߟQN|iDm [竑u<3 0߰s,5FЍA;jY+mA@TRZb5[[]@tQGۏM5.P}$i͋b FYSK'^:H2v%+0ybg1!g}ʧoaUF'׎;Ef#~| ĕ>f>ߑ:q:")3QݥhX{ge ASq` .W"yos0"G܉q w$ջ6WG#-8.>XU@q1~t\N*py&O05@e6#lr~96H }_M60o>= xRk Sӟ9ז6Vv{w&wAu` rIǷ!OJ JFbȪwv "'C(ᢓZÀu:(od΄OM Ɩ§M8TZ&>-^5< i8BX(cJ&㍓Wa dӠV2InI8ɧSXd$JU$vFaNbm4ÕWA#gf@d]9BjV'b9I@;ێZ.È8RƆ5 A75p+c]84V Op f"Ɲے6gV6$ OV=̊wnTW2>759m>jiȬۜMƜ5hone}֢isSWaOGm9)qX;}բMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+۞}עMz+cm>zkIa?=9E<)rj~SU᥉?OTYC_-,y}e_a_U/cʷ{{Wz^{{WzIIs(J#'yzUa3Ta,ӬF[G&HIa]p>{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{k _L+=zz ê35f3>b5z:J$>U$XD71:>He!08 # DOhFe%Δ!+0 (/bGf.I~8=_˭ӞrsTf$xQ6b%$ E*G vַ“NGg;f!yH=+Pzp~s^#zIhaZXU*+23!(dx~on!vLlpHڋ[r%&4 i@8 >œ++=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs4M{ѯ?MC̏O4]Nsy3_+ܹ[W?y? 9g^SK&ꀽUfϣ e/. b}s?9;@=^/kszszs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^qט5]k_yϳ =V?qk9ϩТ+K.;m_Þ}עMv綟g=5 vm>zkJ m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^禽m>zk^Ѫ|ghhf8l2B{WÜaAqq=ۀB"cV|JI#[Bbc4(JEGL !l=qku: T_ljn)8{iU^-eD9jBX r^Wǰhj'1<ɦ,#ptǷÌ8mi%j2NX16H]: (dy X(|tGR1P;yU Ja~>U cFVP},FG É 8OF7R13ƛ*`YZ oNumKa dP("eQxp͇R+V2>*,}+RT(GΝ(*Zzʖ MpIƬauԐGkgbT]e$(yz;eE'Ҧ:x{8 ~nZ*ͫt mN%&d?*;S.IJLQR W'iԟ [3%Q7YSc DF Q)Ǧmj]ݡ&߿n#fLVgU {/ö'D'`oGe$Ov$f8#>dZwoqQI *G*:oc KML"RRmk~*KLt#)bLt3M*r `j8CU%]-M ( H32k[ 18\)mEi) pOTLzEF!*AyVݢ+se(J (݄rAqpKzILF#lPjNɥ>4ЧʆhBxSUOo(B+M6߷%DIǢibuj1PG iÎ)iyZ8hࢫ2hGlAJI;f0Ę4D68 R5 ` HNaƆ1Y6-јܘl.d?Sq1$,+YW@~}']A4Z&'LKGYtrez[{ rVcj-XۈS؜fQmiXPXkJiǗHI2rFC(]|=ܶd^1Dj|4[T(fzߔ8Tbf5 w_/zDE/@biF3410+#}roۉv1LR*7tnZwNۯAJ;hF#gGFՐbon:ctlA:|H;u$+n8T<:ZH${IM~huqRĝ@0]j ?<=>tRcSr3BA>о#.nARE^E>QZӀ] 2g{t4K>C ="" 5nzHŎXmkEݬ_ Lw ”fSU3.8j8 G1Zc NBItm\Ӳ(AZhԱ?@׸ {Ca_EJMT* 3]NLn 2-+UgoLfSYM%ĐoqǀJ 9T#s(b GOp.:"GUOi酿|²(i`Ft_;xPq}ߥD=PÏ%$k*M(jǞG[[ė6R2Վڇ ;@n)~} $PJQ'n2hYI i :NN 96_I_&V<$x[Op'M{+*=Z>Z0V~s"utIvaQj˯m–%o:;hDMX}|nvqPԥkn.?eyئ%q my `tc X-#0ʙNXcQ)x&uo-Ԁ{Rf I#|ܒ }q} S|| 5-6QhB q~  *%Fv NxG6"KaPZ=?9jdO.xvlCg8iPD82oyHV&?^P6&T;@Hi9UIL2\ܟ_x܀HqE6_R@,;vSRMUcUv%7-uz*\ ܟDG_qMq!}<旽Ɯѭq䵞qُ)&̋,ݏ*@q*9]5{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^z5zIy;柂No?k{5 ٪g/3'#]75}sP alr:]=O9zG'1EM~{VN{WN5:>b8N3A&59bxkh]϶$;E$YcڂS‡z\d:?6! ARLb+ܢ@ 2FenjwTb3 &+ak+g=H+TDDqMqt|L<4x|7ރ8u+7PLޚMYIYXw5ɓТ8(a0v#aF帍Vك)K$) У HQL´!@ }s~"f/mONdē [<SIiY|f`"5iun'tTdmns.TdAKGcP$8[?@ީGoYoșG ͙f jo.X~]ϤrR #9 rԨ-P;HvG ?L묡o!5H$hZݤ1RH0 ׹p_5VJb>bo2#5ԓ*NI[G$M#mm^=ţrWB ׈Ta="o+U^Kl{  r? /_՟[=(FO'|ͤw_/gkY~9Mo~"?=5n&Y e{ 3޶ޝ%#0]Q__g֖ўQdS2' RVa Q-]|.v`X+G @틭)W x2)rW iM6))r|iJdA"DO;=354RρX}{#t  )mrK&3;J(83ƙ wuAPq @@ JN*0@)P93L55lefMSIL&D̥R0l9S5D*##ʯhg)J):†Ԅ:BHRLI+Ϣ>FY/ʘ?0IUa,QJBȸ9ZgFPϹv2{CrRRp#T5;nfYfo5yoMTVډJt4R$2A/w w|/[򊏐w_~ͺl]ӑ\ѨOm1XK߾ա}uGyG)gE'wBưG9q8pR[ +ONؔAKg;@'~gXZp i)::N,v| s!!L zE{ԧ #9-f,>CIhjSU 2N&2]Zś18ZYRHNA 8m4s]ֆ˚%$i-OY@qf˪x]F#PPWyXME,4條%xwT<$w6ۅ-;p<;fm[JLIQV 6x׸\_V}P^3lU/`⬦+ee>%UYF_h9h( ٩vlRPRN asyKw͇u4!M Ճ@p"kX>7=˙ zDW`ëqZ TrCE[d9sn$:@&IPL sv>[<Ғ*F.!HV@!Jvwj7&¾wdij f553eZYՂrۅ2 șoww[L&$$((iJ@x ɜTٿi~#T2*1lb<22aXV̴#}撪}p$G=owdnX!2Q)=`N xHg:Z @օ!sJ }͍ph0hs W,h*&hyfhԞdr~Cjpp}>E҂PL pO^+܋i-VSOq6P J.d5X #rM` %A$(`5kWBG7|N~`s fi17T;Rg0G熱lV^קí"%$Ƴwy7#r[|"beSmkWۦ'N=h/5z=bU>3i"Y/TJj '0ED%M 3o~rؘIPHٰh;z;K|%9T6wIZ"HZB Jĝ&p"+9>Mc}.n<Ɋ#rO$?3fRW5"R[r̊7XltqLFݕnz3Ym 0 R#'`|jk1jB*Zi-SpYD dzQn33]%H*Bm1'ҽŗnzק<Oz:e`«k#EIQ{<. TD cmD8#OÕ-OZi-a!I-A*bM{i?ݍzu+R䞬5<6)$Kq,Rh"˙\s ̙/eŰB:Iqz!jz*xjEL0V[kIwX)J :D20>vQ Sl)* $!MNqԩ#`q^}[@zK0 bufS)u (H"KDH^;Z[/T[RL@Ff6#nNMoFb}! KL$0|@$xN&C`z}PaئNU xTkHjc,$0o$Af˹YpZ:6OM, +,ܹIp7Vm$m ?.vj&WZY׬OL++SM1 ʐW'CLu Z.zn&mi-EaAq))ӆKh{r*Sǽ/!>PT0'93dW^ާ/= A7Oq*~.54g+j(OF3,:7BHw_5Ju8aS~n.Ido]$M̐%x/6;vpZgᫎ|# ʽB`L2|C-ᘎ ԘbM]0J^$U庳Gpx_eR+C !I#fДNO e[Y[-XCm֙CM(A +cP +^ٗRRZ+K햞%V6xo#7-(XH#`kndtiZRФ#ЈqEi {{Wz^{{Wz^31VkֿSeegA {,A7(o9_dV4a_{o=^:5OW-G=E(7=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zyW=E{zҦJ\+ajaeq$̽ۍ[sR t:˚L='ʶsO%,R"#ښ]t\[sbqJkLMy,:8S/8^xjpƲRGM)xΔ̴0%AuA[݇o_ËJ‰gd! p)ȍ<ˇ. Q#E@ X)0Udj%+rQu@jxVb| j;5G+&5hr fںUSSG$>A}>wH8mAjfdO2FOvB zfI |Hx$xx4lqDc/:}W>:G@ʀG"2G#6Ctb}Aq zEGx11!" r>Iz|VSЈʫLo`F'o/pG ˘Qa 9dƱcKU-,M$oHU֒ۙ{><7o'L 2<3W.<@jIB:L? +40#eg`Go`~&@2=#Į趹]mHm>/u? p>U)0 ! Ay#Lu'a ^>Co8VzŭX vn_,QYbS巫5G:R6|;t<*Sa1AEIHԃsn41e/aQ%yPT۵ =)ueF6N8H- $NHնJT˰6TkӷǷ%$Gu*[{{kqZT;8VJx2p i,X6xqھڑoq@7\ݡ6hKNPT|{mljr {6;uj:+HN|wq-$NMep ()Oq>:&Wb{Q~UIiC РvV LԎkJ2 Xbuy8cS* /rB봫=f3RDe-6A];Ĕt 0<-tI pW @w@2EPJ FjrU*ؑK鱡0ňUSc~٧uF{+ ;Lk-*걄'|}[eJAG:#E{WVrƭHůx 2Tzzt,K mXF?AlH=#_[C%7pTV>kB {@M&*+Gdb]~/h#@Bgu;O6fc*^c3A6XBR[4+۸ԪIRQI11=Deqi+8?Ck >)RXU"nFz+*%JVvG<5+HέodU]\~*(eJն%:j,$>"f"[.>=kΙųYpۈFGlÃ4RK1!tii -{rZ:ii(> =ZhŚb?neX$Ʃ+QU@Us: 9CNX_s 8quÍ<̀k^+fs2nPrT)Tb )vٸi\TN:a-nH갥M#T(_x7]" 1_tΆkq#Vu`U{Y&8 Q4*O1*{ɪZrhTLהPLpQ,& .ntrG^)!2FO*k`WГT^#4*s2ӑX/Mpsn8#2Ҵ *$s(H 8ѧ@}yRqWÜqck-QYWUE̓["yUmmy!hӑX>fs]S.N:sKxJ&e OD#c}Iע 1P3c8S Wffp$K(1r C$[#Vͽle[v?gJ N) 1QqQf^G תK qjh\C1-}1#rȬ ڴMdD^t`<6'soV뗥 Q Fdʴa4TjJ;w!b-ٳp$%glQ=@º8r.XԲ+ɘPe qjJs Q {'GLLŶ|ח)f)c+iUű!VȾrH JA@=xDoef 8?iS((RJRv^Xv!EblZzXvdu /AR`/AiE*Acm{~_zU_O{,o$u?ʿķj W)+(>jk?Ƞ/UʬW{]?E\e|Mas=pcgwt$|.sg?c. Z' ˽Ek>Jh &˹Fc0FYcݪʘ=Fb mTmq8Mr,lm*d^Rv6WLfədjڔ\C!ARX-~%Va،5nhI:r]mp T!Q"o~@ϛitG685%8׸߭HZjEè $|P~R-vn;徙 tjI- *[ٍޜ6" )iHBS< O@Hsln_ }Z̸VW'*_)-K4Pnll4ͻ'Ki*;a 8W5lrۜef*)m Ym$$^uZ^k34ZՋbT՟.*<#y'־nܻ[q*LH"clO=}e& :Фj1+O~l3%\_yd*0jv>̌TR2}#j]X PN(ĂGد}ns28Z,,{p= ;#{пW>_K/CӜ)),lNjI瞕 jHwBB5ˬh».J$L9nn-낢 Ci8HHL >GSqĺgt0u#/dj!A%*1>4PRR5|xsb+ Ur?+w#[V_o*` ?]_P}Z^s~]͕.)4=UU=*,3-02'6a4u* 6z[' CL /-0pYb0I3EAݱo8yVe"W 4AV)I^plx._ DPSđDUt(Li0VVkl_fI$D')V~?̓rIߏ?cuPkQ*^[0JXhl&1ƆY琪7+wfb*Q]$~= ƝuOgvJY$fI2`8<V_Wbwz􄏂*\aO(  #Ny.5hʍw>1&О#ޚ˻GNM9VivR5* *|CbO-~ LԘú3I#*3OҒ.ꭼс)mFރ%'x#B 7#2[W+n'ݨ􈔟H r?_6V]C:N7g.k;&ukr}t7P|0\I6Pq:UI,q !i)ք2$B foڳQ)SH|]8٘d;\\-Wz'kJ]QJp &^}Wt[&bU<`x1MM4k;Ēe_6ԩՁ%}`o˷ 8၏>k 9v=+ ũ|%% b*%\ËLr7``j\#] ^QB ('QHDD~ů Z:elV|BDV(ᐵKeeB_Sٽ߶7%@@3'hi~e6k6ԫHBP(Q*4+0JL =Ͳ:WӜ徒e/0aY[ /5I4M]6<.7.)mQ*>dɮjfW.v5٩j*1&Q5{{Wz^{{Wz^7VkֿSeegA {,A7)o9_V}4){o=^:;yP}mOz{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWz+z{o=^=E{Wm^syWө 1W&dBw)t_R<zfo5COkXh};cHi$n7o٥'PV1&ig_YV= 0>7|B11јE-Gf5qTudx-ي}CEN$?:3 @G>T׋=RI(⺐\)&Y#o1ײ8 Y* F1Y|Xq7k# 39'hw_*{()2poΟEX(~)匳-3R2ʓ]vkfZnBq 64MDiOFa1!;o`מqpӫ vyH@@{Ie%PN?:RX lEGNZ 7m\{xi1Qo{􌷼p A N0QYV38qǮyq {?ƞyԡ?ɶÛ5]7C LZ5C#AiODž!q8 3/,a^;GGBq8*ù-GUXЩ#IFN (9_)4ϒEC{Uo: 1U&q":q:|8%uKJNA(j=T:wjW({tHME$8y6t};}G Εl&4cp5$+hb6 m\CU*mw~O1KWaNI !}mĨJ1OE*Z[I\鎚t0Rn* A}5qe^-QPV)u#~(6v A=tpQ`O~>#,-Ā[{/vW!>PGhª,-}nm'I{$cҤYSmU I&۵sƺLG8d%6@xŋifV>ӇҒ!A;pScU- [w8bcnjĺ ~ }ˬ)86֗AK"17Q>99Z<ܭh`,??g.q<~':鄸j`2Z lM)kgY#K6БT =&2`t튝HG9  ӵ.qܿN.(H$WiC= k~u"#hEqlٵ3ñLIsH&&@ Tw6@IrB&*=hE2.MmzcUby|%U@R4f32s}tx|\ Ц:`3BD?S7{\_6`O+*/؇pOf"g%ZauplZ% ঢ় +GowǷ }B;0C & 'g$KCn6 GȂw7=nz? }3zڃE<.лG u6 䚡"`Фu*ߊcCYX+eoW|Ph׹ T+冝 R{`m…KQ`gJm>#e+x.P}4o2O|x&iSOulO S`i2]I#mM%&yR\ L0pQ{G2)dEC a̡EƜӑ\7355p+itUO{XiX3.9JV&. <)NW ݸ٫\2-~zkW=-M^+v 暊X^g@=lӂonf 8onfErQ&yhrWýTnNE{{s.&v UonrUsD⽽hr[-M^+۝jjV9pchsSW綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5on{hs^綏g=5讋={9E$qo,<禽]_n(fUᵁ**߱Q]\INT6ΎWK[zs=W=^szs=W=^`$G^=^y`WgT԰r?GwvgWw#ޓ Ϥ0C"WU)ʧV1+̻̈5śG; P+?oÏ'4嚌Ǜ ka)[ٮ'5#ev,{ϮZ5 :t"5؎;OEH)j_n"I'EJN vҗ+G½µQ>Rgo窫-쿔|>|HN rJ pC,pL_ZGV߆ܫ4+>j (l`_q}8(M{- Q1-G(h.,HxdѱN|C]{XRw {!)& T cu?/*7jiir{)"?,W^?x/DXƓi,oڿܛ9b\۩0R|ݫ=iNGg?ïqKG~):;[,)?&d[z_T^q{mGž(q>RW/˸0RGĪ+lA+M;خ'~k5 x'(˜5{L "<@̲Vc_4{|ϷOU^ۗOް)Yy '(trVXƶ?j<"/>`jv=j)11%B:ʕx0AV=$彵J O$iIpmˎ~/Gtq:HuG⿈oenc$zx#p:G PYjzzQ"FdgF ȑW 0<8@ XJIT"Hx 7գH7t4ڕ.jqR*LU{~[ߩ9ӌ:<{-U.0 FţgM?!(ڤ af,d 3!'l0%FR"4p֣jK$j: @ޥlQ>@I/4f] 0R3\9~o+W >+ڟ"ݍ;_ڌ%!S[&>8׸]/ӿj ~|flgUdiU$NQ@Ďk Ҳq  d9]CaM)6׊QKE =UXG\v\:ӌ_ YW0ڼ:Gg/[L+(9O+Tb4،4rb|C+!]϶c hX\i\@I3n$pbݼ>5^6Wa xԩ1&/>@_.cUۈ  o&#c"c6,عk%$/>rz.EYnO&]u'C%<u}s},Iwx!QĪ%ƫ1̻K #%MEKŹ!)qz,J4-rK1E{=)=D>TAo]^I RI!IOPXIWD?Nz'EH2QSiW+JJyb8 LE{_ZX7lFRA}Ֆ[ݼ6ovS.J2JZ{1\@'scfϔU^c9f5bpǺ & r= )1A L }Ղ66<uԴqZ%J=COWD ܻ/)t1SuK; Ǎ<^LO&l:yZZ4$,K;[.8aHJRP bdx7-m6iu @Bq!)%k+\*2Uҏ\zEʙN,.ZlqGSOJGVϋ³ `e yA@WK)-$LIW:(*k*SrHhOa?&PLUV4adDP\_7`I,WvDLyҔ`Pq:Ff - gp\xt6t$ B @QXh$Dh&V 7IW*V~(*@)'AciNS4 QbPM4srN|X1\jPnWi ;ˉe+*Sc8$Ŗ36U&5:x`3b6=u#Ju;'4+D04K0WRv vxrYhL Z&0 sZzTrI'Aכ+  Wo*;I$  n^)r(%nKh<>nMʵARNh*1)qJ<hh=Lzy1xM8MP!G6 u X(d'}B=Gf7ܖx&փ1zR(8yDNM k ;C q˱ń:tiW~\ϊTGIGXiF`%qq:ݾyYn ݸ1B/K ,1Ɨ=/M ZK'iRʛ^צJKLV6c#hcq[|=%OE [ j U-q5 /kTSꎊhRB}sYkE(YЁn'RTQ4 >໓wSOω֕> 8 K6:ƣOKbl*8LT"o?W =4tT KOKJmoi)ON^$G&zDV3cO~eB"K9O0Ku9R$mH7F;d6F8l\^0ۑ^CP?%"fӯȬk9+WM@4fHd]7oAY[}FM~?&1[VIcVM4ׅl<[AQ&( LM5P==N.Q7mm8CKE©TF܏^lT\|,2hk|l"!'ZُbowO6y6BT:}G0*(,X2n=oCQOUM,U: 5j~£Jp/d)0@{vp[(E}S!Ό=2ɇVEc_Zk*(<3PhE'pHәthL${=J֩4ҘgApN =^ VΜ\.~fUl$yTRΊ-~6j n\t议=ʊ*jX܍9%Tƍ9̡)5qXFF]5*>a%A•i1.4lWV@u ,VCgM}n7r}nm7vٙvLM1&[G&HCl?՘_O0.= TPIY_0oHm7>r^rL]¿RQPʂꧨʼ}fXjخ'SVʀxrDbѫQ !)|+'ܒ'NF[hxO{ hQ^oL^:Irb̩/|3K{Lěpm-)P@ʿ⛆ q >Ap9N#kˊxuj~c&س>AGbޱ܅!{tWurG&O6|2[r%]}\%D~O.ェ~Ԭ>3 (gZ}gT${JypK8T>8~ZDbHp<AjA?:lT771h[7glH;z23P}<#s~.Oڄ0T}s /6(ʉ ]x&x6;[  W7R<>s@sV?i?W2߁eY\S958XW(h(l;ۢ@P+f&W0gbL-X"}b|9؏!4ovB>3慃tu{|𚬗->fW,M k$m/;D:<hD]N&{׸,e/f_EXɦbeKV|-py_sL|h2h;YBQ;KK ? j~ yo?R<%LN֎I>.'(|y4+ܬ_mmh{aH?nzCɖqR?īC"x#%:cSB7 vs_77MWRM2f$0^[7:O$nh ?KtKNCuްGx+({рn*>ߧjj+̽F W{X;?p17JRwZ3D|)?Qd{kZJWdG9&L'x|R4'W2{79gp: #^=TtN̘^-!O=)'[5$0E2ۋO!I^(s=W=^szs=W=^szs=Wj1.[ $H?O)it%GOӝ}u+eY8tsif2xvUr=?!ǷL{'0xK q*D˜S[̤{})v;7tmݫW{_IX:_>b/g,:>\MS-pT/П)Q琢3{l{=4W^}Q@zDty{.F Ef)2jMG񌏇 n3+_2隆7W K`{#ν5ue\0v= qԑǃ{}ڲ'WV@}TZgҧgdؑ^oۚ3.cΘ^/OU2TL)efvm@*yn$lJ@H@@q=ǩu{D3eӿ|oo^$&cO-aÉPaZ|ǾMTm uK,-`_ð~G:I7Y#tù[N8,Èƾ{{J:y'cJ6'a/mx'p*UA*є-`/c݀.=W)>†YuP0i1($#L۽;aÂ<һٮ@:kp.'҅Β7'쁩[f*1`S~e( &ڷ6z$*0< ]9㦐v݁c׍iR(VRI\{xƐpmqq BZ/dBP<#7]J"cJDqKiKQIJ2"ÍA*8O*$ ہn>W0WI*Gc7gl y8҆ |t *-^ LNm'ÈJV
4t<{qG]R`1j}i^^QMO@5{{q،Y^7T:Ӱ: )|O1Ԭqҡ[]h,{<KLېko$+bJj<,„-z#ÊԽdÅ2FeٙZ*E*[o.:BQStb N=1<EuY8ƃ͐izLJ)ٸ"~I+H_"&S(Bl7X. N!r3n>u&9-* 8W; דO;it |ĿxYz!9@MFq)5g(]il$Zp4ંtQksemqlyخBA7[5 'Vׁ_*?ˍaN [F0ĵBQW@pB vLiF8fӴ^!'AIҮA4cP ib0i^Tb'M94Rxs?)NV>tc3Z!ӍxXWa{׷"O$KLהB~w<"^5r+G jdRG"\6J΄rB85My6n|x©,/E'D(fR)v<q=}*AᅺT]pJM8af#0(mp߸ы_h\ICSb(\iZҁ!DO`aIRDԧ4burGkXf ETHMEdt(V:iXxfc#pi/}+e&k<.u=Y)q@c`3J|Ǯi5 ̐tnPUMcf[iX[N'R@E`it$v+fٍZGr\K()Wr^&R9Zb 2!ו5a\sS\ӷ;QsجG]y qpW Z?~HO:+}n<;z3r;XW̋SV\VUsUqXq±=Vszs=W=^szs=W=^szs=W=^szs=W=^szs=W=^sz==W#?=WgooC+?./ ?:~"\+їtOa_S.۝!Ά{{Wz^{{WzIIs(J#'yzUa37kI(K=tU,،ƻ[QKA.+VHXS|RI@nGw{x2+Gbs am)aǏCiz Ngӥ?Ŏ纕qMNX1i/#Ir;+Ǿ(}`{v/0Z`xJ. Z'J} 9*Zjb)N۪Fk|\ q\tqGQf||3\3r\VA^(ںk=^szs=W=^szs=W=^szs=W=^szs=W=^szs=Wdg.f1\Շbtr}*h%̤zl\9lm)$hƽ3¯Ǥu$)+݌[SoKN驃/=?]{ԯMOs>QbQqU@_O4P~<m }uNoyݮ%GH)W Hy5WQ-Y%GHKT S$w!GOFJ@aڰP-׸C H2^Y{7*h񴉘xiGF +'~U2tS?r¿Zzs!U6$ x/6?ߢFwvs*S*׸b~. <?u+:M^5Q sJp66WX4$ 7-Klq U?)\'ߌ!W=nvq͟Dl3O/V]AIջ6*Z;&v#N{ OwUGT.e_coQZݵ/{~)[1'-W@?vIb=+OOt*Ge N7ñ}՞3;?`*TdS]opߟ`?ޗ+Oc޵"w;=\M&RnՊևGFQG? k@DqYl{]W'"FƑ~4!k̉lz^)[;M͘O;_h[@JGʅn[kلc^c9Vk񪩫'nO+Hg$) m%u{ܽ?^8i(T($Uc^OWV7i֚ŦX|pqB}@+2NdW}i &F1Ut8 A ԭ1p(سzI>/vͻ86 O{CoKUq}R°/TW{TOVԁolrlP6glv_AqiGCy׹k~,hk1k#MNJL #H=|o%(ތ}tV7fgTT^=`&u#K RV²i31j|* DvY0A /k<.˰QQbI?鬦7EnjgI0:^ff?Wr+~I|Mam?y3(T740SV,Q'؏=^s&G=W'=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szsB}o!~f+k}5p]iw'Aq@NZDŽ|}YS'eT!Ia\{Q*lA cPl)F룆$#TS'O$yPPhMy2`ZwP(҅?jy|j6@'X$ IRI#wz\Kॎ+(u$8e**ũ)MZ:[tkt{,='E)ZI?N51SM䲓4_ᆌV|*.-ۑΤ [IHۿx3Sbq@ a~LJжRNC}P4}LY@T|FπFO.y!u444"ՖBǘ))$0eF%f"I(ٳt;v= nH4d#h6e$} ^84p /؁'KH'sZjd q:Φ 1.ү]tr6?'O,RA )X]0::<SW6ۄCYZ z1g3,=آ$XvLj* WWN'RHjҠzKUH6]!U!YEߐ+͖AQ|zjKn=ۅ1Q֚VJᎁNK|9'Zi yct;H|S™)Or em{,oTX,ToUT uOsmv*ӁZ^a:?0-Q=@XP;{/˓PDQ*iycdO3lmwUe|EBo-5.qCEL)3>][N]z 8L|g@50G)0I%3O@K_ `XmQ8p\85~,"|r"D?JO^KL/.o(yӷHSᖆG>Xqg0n?pzL?`'@&,)7%dI)n> ]u=lNm)gOC[*Vo φG>t(i*|+U%>)d_yهf x*%8 j 4ʍ$wi$e:(#N y"sBhNd("cK-Yǚ8L7F@u"H܎MHIUG}ğPUqFo{FѬ߷U&[kiVs^BO+5j/̋5h ۔Қpl~JYG?hGE:_Mbx(̟7^l+4$lXLލH<\du&2-/-Dk7tZ11]tpTi,W+ד׌ÉҔJmoQuTJX EIZY]Mہe3U=fR(ku9rz]yc𮛽 y^5 y[þ9^Ub~̽Jp<Ʃڏ\^yC[sj¸?nd_ʚb^R^.j^c'37^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{yzIc|yzE;1^ytxmaݿoQ];* ʘv ~t5=W=^szs=W=^szsHM~{QEW>s?ǟ6UxJ/|Kg#|7of5wܲ?0@O ^` cv|5G'KH?0vEj+l)If?sbOc5 {*-r^ljk(_U#)ǼoNlw> NS1\NZaXow3vE]S^ɽ'gNc-aX `vMJ.!vǾy~5]W7jWĚGD{Wz^{w§.Ks#7w諩?Nܯg{H[dnU?Vyoo^$ڄo)"7՚9r܍hG{Qc Q_Փ{Wz^{{WR2Gzczp╏4mv*l8ݕ\-j̘fե Q|qs=^>1SԌC&5_W^ԙQ3La$$qGj*@9 6#A0"Nk6s2PȶeZʚAQJdIĚ7:i+*~c=3zQAoR$R}.I8ڒ J<8$@WV-3[Bmh%)Id THrxpszs=W=^szs=W=^szs=W=^szs=W=^szs=W=^sNQǭedOX]8.+>Q)Fo&<KO#w3,C-Rm"zIJWaoudHsXC}*)ܥAQ[ԏ*L.ZqBjP 4ny.l)~,,Ą@ yZޜ! 2n [BTR!21Гkݛ\szs=W=^szs=W=^szs=W=^szs=WHu ` sAĮW=_Ctzi' 8[+V6){QzC=W{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^צ&/-op4[snI!&ֺbT$+h:ꉱ9Z "T=b{,b9^M\ xX ?O8VK,;~quqG#k~"/-5y|!w^OJAI6LJN0f%Du7v&ݻ3bx|HU_"iV@>$'ꎂ#'H]h UzALDSS*(MºZuk(3bmQ'g4 /GFݿDjA-F6']m,3q?.mQ6˛qtjqlkF=\zkE^O9$!Noߟj`iԤX#'66>{-hY`1m-Z|*3IA*K1Clk~|Ҷd,UcJu&4 r4n靧,DlcjP,}okdаwH"X_٠;l~g/x/0:j|]rGD(eȺXsÈ:Ll=}?Yf'oGWG¡P.%< Nqݚjptj0?2g;KtffM.<)k5$>{ N*\J*%bm_hŅ,/8tHjHm>`F]|xj^FGE W Ai>iDeY`|BVI=#4(Pb}N'5_d}Q8Y:̙HnR][rW *'xr#I-.`tQ`puE"Ӭ؜V%X>?Bj bUlYěo⊓XxVMMSםļ.x8;|I:)?P??`46GQLߺObfܦpua'h~eapJvӒ=F' u|nuI-}kh5ۃ> ) ױQB̠R@r)ÎLJ*&b-/Tu7Ϝ}<9خCu[)^@9+؎h5y#vr{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{WG$qgM(rxgEᵇvOTUþKEtZ2{+*bs5=^szs=W=^szs=W#?79zE_d?o=W:F|=Us*5,?圏]ݿu!(]rÿ?+s=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W@3Dښ|/>nd^{諨N_ekܶq31⯑Of'kREP_.3ڱNI>WF?~{P59zY9z^{{Wz^{}KD<[tl*]H_ _Np>]nLݬJ-U.R֑֡^>8c}?R+3) W:_ttޣإ,rX_^diz2u{Ȯ~|;[A3[OQ?Yǿ7)_괟OszP'sϰ9zO=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs?ЩRsMUic]6`4#g9 pH8_u܂ق1: ٥İ5xaPPQXc'hb`5 L9Tb.>9+0ygM$Ы 1-c6t{yޟtV*y^&9T~ cfE$yD;{h \[ē,[enBpJ\~Y'iG᫉a&E,[;.)k1jՕ\Z0P.)$m'8S%n>pj]w$6l<U,%A أHk`JSu4{k6ZM@ӯχM%™1zyq)jf~}^/d Ӽnl^ c–4FơTCvn6|Gq%)`Ϻ f@O8QA>gko9ċOVc65ME?L6kjgZ>Mk6I=5ɚ?K l=I-Q[oEp]\AcTOFx k#afLPvzAғjOktk$ \ vbgTsƌԂJ#מ6G#ط|y M7?7goyEZaOQS XԊ<ͳw<0ꉅ!UJ E͎.j@'~^ҎӕTi3n[oo%UQweE[h|x xLƝ}|xV yP*} rV1z(Zgtk7çNTpy4hy HK*)Uea#On2L 'ڠs:pQr5x@"Mi ΜI9ZhQ &#ǰ{m\*HdHl{]P2RcMK5YN-3nLZ: @Ep,>`` `'VA_ 3dckz?i1K6nb+6Ux:FZTt'$wRT>gST5#R}gI6*Ԇ =5TQP|@fMdJaSRTt2DELқ[]œבn#i~U،/}WOU4zdzEhKl{jduqJɐZOSIvlO7,8WkQVN?G;Y)5[Mx),^߻5˕Ч9TE`ЋiRǿsUc(95%mmdu&F^+^@T8.2Jwcl//bܓFGm kp˝n੔d?T{:"ŵq>Sۅ Q&^;]0:rJofu9譃]s.cEZkks5x$' WҮP-ԯ9)CjUZG]b+(TFUUGPRk$ Jݏ[M%%S6"hYT ꂹIqW|9JxV9<9~5jcÙ)N1u8)>Fa@T7Rȣpʳ+Bh"@C[d{b-(瀚TWq(ݎPk+ʳ>5yeA s25`ЃqP駂Em/1ԭƊ)W]Oibn ow Hjp>- {Ƽ+rZw&moI@fR<9JtTV˼NWA5דhHagm`G>R*;w` EH"*\6 kyH#+[s' }ʥ(jÙJ<οg5zkT۔qUV4#p4V=aSUOߙG~RÙӷ4bqf_{+Vs"Tի29sUz;\V9<9q|U=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^csHs/|P˦k~}xe9SWT˶Hkyz^{{Wz^{{RG0osz/R~{UXuA6>׹m!fb_#X_|?R)7,X!Zj5u#y6_ ;\:6'ݏv=M]ʋO5{ z:L-ǝ(oْ?@Ip~_@EW]І2T{=+N}uIS5{mz@7HcgJtCyCcϢ{-asF8 k FpYgw?I'Hlt E$RsWJ*MOTl<%y '^%< WΞj3[OQ?Yǿ7)_괟OszP'sϰ9zO=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs?ѪT>qwc쮿ߞﭗV/~>b#%Xܓoۆ BÉEghySE9.=s/4MD\On~8A$ت>k#˳wkOJ_Oh"F&1fz3YM2đl k^CtVfU+~4ҭ$L̓ (uN):'`$OPG8 YUI^e#4kk{;tB 2IpЊJ *7Iny7U=VӳopH BzV]3JhR70;;Xr\X4$<]@[t8h%$M@azDwκiEN=N+` cv.g#W=^ÇMz +c^ME 7@-⚚,9VS+_xXY= 8T(xRG G 6HI(1C4+-Ddɸ)#LM! 4 YQ@x<߇U5 1v=u5*,dK卆$):| ÜȘ62wkT(}U\i6c"[ ~?Rt}-~e?r13~⏏4>ii>A\tlB}ӎ1Qm'ظxOҕ6QZV׸R@ele ;{/˱}1E=|rxP5T'CLɋC GNszoH\asq]ojI f֚ީ08B9rIߡ!?yrNISDcOnEE?opG &:k{bMo~QF)ĉr>DRC u^oAՄl=qKc'nKv2~ºSi${ʣ"yhMs y];T&<^Mr ~ǿoa+y GEnk󟘚o+UyA[/2E*~nT5FӋܷQ8T#i5i'>D4*B@<$t&+iy͑[m2BksE/dMթ=8_E,bl%I{~ۜ  Ṱ;|Iq&dz[T? ,pZ(#JPO2'aʚụcÙV|̞<9<9r|mø Ae*|xeOРƥ0($(<;yЮ~rZr=~r$U@ړksƽ\_$j)d_FDU n \s&mZrBg5y$-4lTqƘW2Bj<уq9 y4񍔠Qմg<}Ë}dž 8QUŠ4D[Oˎۆ4N.O SksI\m~f\zM8.X[ [מWeU{̘pbW MAOs`Gɑx)Bn a|62=ӯǎc[ ĆҴ܊cE4?/6n$UiXLEC|2977mH5s/ϫ}yN*(;[֨[NPl}εƊiЪ7¡4Ӂuyev jK yH-5BtkMoP3ξn?h] 2B(SNWi«_o3|xM8X-ۙ_Ub*)y%=ʲ{yB)kR5<̯qqNXnoR5m̪OavCTr:6#Vy&eA/nK -xxpTW}ZEĥ*PGOz\szs=W=^szs=W=^szs=W=^szs4P??|+{G*'ӗ{-\d?_x}z+kZT'1ˬ7(`6S#O9zG'1EM~{VN{Wz^{{WznqdԹS |6"`SͶ5ᥕy-'j]'cB(^}z͓{]ZQ=U*=Bϕi̹gűʊʩHQS+K+;'BS}[[dZliB%"Ϧ?H~D*!XzUjq*jC7yrIQ!oܭh϶o6~JxQ j=d׸`ފzx:4W T+s |[]c8Qmhⴴ'@%l[BIH#rez hт˿a\{)7d{MIO(qS^t=3vHOH,ǀ L5e,t:25ME~v(pp"+(x!MP nx^tI^{%s{5u9˨Qi&(8;kuoǚgYi]XIJU# Ǧ^=`4ޝ+`O6Z MK\4i dqTԛT5p={ݐR:p#${2 7^ m$V A=Tp;Q{j sYG϶4ˍb(QG.9&Zu{-n#H;}{_Oy.V0i!TGZR=Ks_oǥ>V#}f/d&+[BT@^ 0HX{B/o,/?_SW˽k}]{^sY?:`8#SɥMd}E+;mE,l4KuHP%$#o-\uPJmiL $11^ Wz^>ѯ_z`Uꡎ$z]XQ$A[`ovyEa($tREYVVq?ҀYJ'f ߌ?AHTnʴ2cX+hk1G 4ї}/Z[6IWX2?bh(ǚ+Eh=4_}MfoR>| t'&VU;{ܰՙ?1o Y{YzW[p`M{{Wz^{RS(޵yii0m2aQ=D5&vl ɹD/iI٪1 u'c,7;ɯ0 EJY4RRv Z?œdܸ|I2~Aj`(qT*LW3#JJH&@Xv)ARRL:AbÎb7f/;H_5$pa˱Iy?goK]:GHPR;IWFhٌtdBMtpʙ)n#OÈS)VRյ)ʅ;r4z$j3|5$LNȌIe(( xS($ispY2H[vC{ >q:6" OO"KNGdA tp0k,XT4+l`[k/ڳ6c\r|X1C:D)wn|ub&F)=y)N pP"'QސEđ5#aPڔ`v{s^<pt1kk}}-+嶴>àA>/TOxh3`YFYvƌlv|nh<{p7 =C4\wYۇq+N=s!Gð(hY2̱ #n=EJWeZ;:Iێ **@I!GakݏNJLF&Ar1v>v+R$JJ|@c>GI$2K#YX'?p|c`;JS.pLv0F|>߉ }jNv`0{n}+9 %DAk$DcrğnB}|>JͻU' 1,7O*ݵ\y:X64A|J#KsbmmQ] <iNE=B펥dD$Pw35!6&P-,UU t<6]cjG iaߘU]jQ\2ڷ"6n~<)׶WZÜ k~Z*\sˊ0×P'bB5μʲkW_ )kM5ȜOQے^|Y|A)Oi nDK+2|xk)A7$`aiQ ǨTf$%*mw0)K+ӲI5{i>>H2%#j_o1 J˥9е\V {s't7}iVpyH{6-F;nH?X{% c:^ty=M>!ߚm9\9ހUƼZh筯7^Cin?@6b q5$ʓN$WkkEXq" 4k<5qX[ۍⱞ_~mѲSq_M+χ%ۍSw2l% ׆vhJ=E9`jVt/ wUq\y|9SN\9J<N΃E'N6b2ǒInOkxGkך$V2~d)5ho^H&<+;\. mau|k3"X]#6ʒL@ &lO`yԞ4@$&Tu6@A5^ rBRsE:k $[HJqNbu8Haho)2$2 K;q,\ǛWrq^d9X}ywjºt9Xߙ9Zce<׹ra\2/MZs/)[s5WsUcÙ \Zs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs<=^1L<=^ɿQ oH6Xwq(F]ӕ?yL\nt:מ{Wz^{{Wz^$s&?g=W+GU]ϛ<s¥Sf?kN??KnYw ^}'u9z^{{Wz^{{Wz^{{Wz^{i ҁb{ڞ*P9qt0j؁|8+_Gl_#N>Zszs=W=^szs=W=^szs=W=^szs4P??|+{G*'ӗ{-/]tĿOo{'V4#xI5B^o 9skhtG{Q^{P1ss=W=^szs50zhJS,ZDžK &ɲ_Sb }?ss ҟ$H@P? 5=0'LV0;{zodNڔa< pJ½w0?WyqEw-.)]=]E2XS,*N!ѽ6XТd+3Xw7E+a6BBR"-jRd׹G} 7W=lYR夬gh^D+WGEe"*(yY}Sz/wG|,VJAH>`Y'mϬ?OOIQM-+1CSӽE\kH#4ow_]}˓sl^I0G}:;q݆\;bWڔ:D{WT> >aޗ};'َD,yWrOLyHCeo,v2%+ȕxǻe8#D$Y'92lT1XCC'êՀ WʋIOO9bP͓3U!>|.!֙4e;l( Dϳz cwEC jHq#Rc$L1^D-wE<~}ON-e:ʓWQ*4sH˶+vfHuN!QT 5RGss`S]e;mxc) J*HAmbRDk^jJv~|A#>_?POVUmEVJ֞E#B;96_@;U?l@O J-/)z{76 Ϩa:aLOK~|71o&;>gO*8hᏭA=v{W貰6ZJJ&  +ܷ/fs_>NGK?ҟƱކ?u_I'_F=gH8#DQ2Ac,߳5.a9E4$6chݫfhlڊIЂtJg^fՖ>[9ʾ p$bcRK,B*OTI86Xmli-D"I'kf.3_=%%4Q)܏xd&y),rK-ox-Q;Fn7of"g 0ÈTݵ?f-e[8JR[*!$ 04DŽWK:T;G$lI j='&4@PϬI*%wJns 19냋7̵4f}^ vI)¾i4C_`ZtŦ'a.Qb%=-$RM40T8Գ1*$g%%FE-T$I8+ezO@W̸ME*}!h!7#Ogn[f,C#RO0L;dTqYgeGֽ/M_ze:#ΡF!u_T4jo)Bn\w󷊍MS\ew?=?̝~ -Ñc%{{Wz^f~(_E<O'O0o(UHaIMp\b("ɗ;b*WW@>=ySZ*3}_<}b&x~ˏbYb1UUY؝LGJXX*K,Fā !Mt7K[wї٤6TS6V9 N'Q$ɯs{>bqƽs=W=^szs=W=^szs=WHu ` sAĮW=_Ctzi' 8[+V6){QzC=W{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^{{Wz^ө cl-8>  tr1?+*Dqیu5 bLلElC(PdUݻ}9.K*5 l>')$(1O @tO3XjTrES0(;v`;g2TFOxCO4N8u~۪ 5a_ﮩcW%&:ˌ3[OxɍXh}lO ?-)&88tQza@O aNI =ob<=ŃbUJ(af`wq*5h^vp&(l@x4)cƝ$hAmRm 5YTUAT Vj(kG_&H[mzN$D9>[1$Fh WR/XM$6KXm"$Zq.@hBH0Aӗ@^˖׎92x^Ho2r$lͧcĶ+N JHITBȪ(+{ {WgiZY =sn'U/ng8ݑc&O=k-d"2OPH+0FQGm'm xOW ;c T$k$ , '-mYz$h @⢔@#i(Rdl-*8mm,r~;+VzWv>bd%{'GܼpxtA1Ǣ1|+#VBl-O ?Qe)&ydW>9{JGɻ"q3uF6T5~QœfF6R~~DWgFi3"?STDIqrv i3|Գ(3ϿP7Wbk60"7Y1N͵w=.8 : e*d}n6%v#q:iz+Sv"#[Gtmonn_Dk,X~pkߏ_*Mr4Mk0MSʋoĶz>ڜ#JȔҞƷǧoya~$+|Zť[_~wRe[xBwCzzzWM.,?M]D ec}ňHD52c(oe[54AⰎI F,ܿ@4JVG qjXK:G:Ȏ>RQUDI$" 7#@\;0X^ +yK$x-J-GO 4yVU8B:CeR0{y ^;L-nt jMnqbQZj\\ߞڀjW`nIX!c{ZQ̸vt?(]p5553-|GջXc4-U?/w+*FHc )'xudj?4Mx?dkMp%,ROgNÍcQS±x٫>JfʒExdu]IC$P[H\i!qBW< f; YI‘Ü/asMvtp-v<1یx.8IBahki$vDtXYrDr&"VFt76LiEF#jk׿9j+̝٧+ywjºd9\.f_ʚ{+Vs"Tի29sUz;\V9<9q|U=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^csHs/|P˦k~}xe9SWT˶Hkyz^{{Wz^{{RG0osz/R~{UXuAjp35v9 1-N]\v_IOҡ>Wb9Ȝ?ܖ +GY;EܳD=8cfWbw8<lK-+%#'h1Yc *84{*=8"1{s6FF l3*^,#N= DL1X-=?byk+ = Irnr 7 iG^+}kܭ+*#ʯ;" y Aȃѩc* M{(J=W2WHzԙY_se\7 $6'ݸmIODwym֔Hrz=1~$gza`t[uN`xhk]*OБ1p#sV\'{;W2u\gr|O@Wr?_k{ Z._Ecm=+_j}]c 8ttG۷szL$=Wae{{Wz^{9ԷJ!Y§ lɕ=U\úۙ_L_yd{#d(Bύ#ѰGL׹g߄ߣ:βtL^'i)>#Rt1RKT)XpeofW!-2N+[:TDǞ75l;t RlinOb96VlUsub bQ"[K f tk|U%ڵeHIdmQ6}Bi ljX~i(;G1pe{}'`w諩_NiWuzxjf<)\خ}M:UA+[*q9vHhb1@xEWCV. VQvx-ߺRiOgWܠ_v[Ajb5NZvDe_vE7Vu6QY-ekww;?z<8jvQف?;zAl/(mH?ơSp/$0=yesQڠ5EVJKvsrbXkHӼpZ5f$R rM[%[ 3ʶq<<-(ǖ_:̟ٝ;p G{u׹  1))#i#8Ի# $.ytĚu $I8x 4˫Ї i:}[GG :5&/>-Z4'] $Y?e-1X/BGO\ &z[m~Zsn08üY!*WI*7צz#ti 6cOWP O!.̀ }x:ᒣMn7ۓ+pRG= H=ɯsWPG≒v[lBAN8B V$#_ǨIt2cXaW!.= yw6H,2e .i2gjAW+*RN ?S?r>|Z{ g6Qc9Ǖ,kW j6Фaي䉺_LGlz2Zy_FSD׹7?O}X>S#49bw,5hie)pj衯JE:, cH['f0NH*>d{#_o62{\)BJI"H/3LJ,˭`0ˈ5/[:>rOJ>^|*{{Wz^{{Wz^{{W 6]k_粯z2ϳ AVOqW9:'mS=^?sz|3{S=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szs=W=^szԨ|z # -59EhT^?s6[L?u(g'Pl]XrS Oo2m)Murq k=)_JSI(JR'b84{~= *zi1*G8 E$o88ge'eJ`V Rk##=7 ۙv*i%OHiѩ{s`7#] Q=.jܠ^X3Iˣ}ԛ}<*e͉|oGD 8$tM7XG=}dJF)of#[}ˁQⰫTS=pn$r B1:DOʸb3DRX} }tlZ8Lo:栲c7U|O'A3>݀IgΕ?t6q 'q!6[6;JJLdS% .ax`=+nu'|!$_5mw`y)Iri]$H( :߉&WdwbyEƟ@rlY9fF%Q#-r8| G]>,u3QdXP r"8s~IRv\BnW|jxs岠RE~;`@h$KDAmϙ{y+w/榷#?>yIkxV~7+9 9ok:Hځ)B#V@"t.Nکp A#ǘewjq ɠᨦE93\JmH׊IԹR"hBogO, GuDI~5'dqniTbxhefCtn5ԼHvRE6VFƦP7 oFWSD,}p~˿"T;р)..:y՚%RuA )Sa ~x†=f>IăGPT荸x3Xɻ]Zb4~@oB:yk_G>z}WqzV\|XjQ&le'wVΎ'b>7 8\b 4NGqM%T6aCO},tphɣ,N U#}e67< A.E5YϷݴ:ywvWW~<<[mpnܰ5+<ǯ-UzsIS^fEAnPӃOV ۉ҉C72\U$s}dXv&%RB i6I p\iz{xb[-|@j~ GΏp?.2D [ v'S._5A%:{{8 p[c 6n%SҋS>XPi:C c}ߟ%E, S8R"9,5$,*MCj p?)y>֬2۷8DSuT߿>thw8֒jfӿ?WisS "ņf`QT!uu}!!OG*mHZ:.x V)'4IPNanx+iPÈ:4Yݾ9^ oh'Τ{^T,F- ~"H a$bȌE$xKTȁDvl/0p(k`HRZ!VI`piXvgNlӵ:w+37WsNV0ƪ'+OW qpT~H^ÍU̝(j±BvfX2RÒNV\Ν٧qu:+ }MVxm2(PXpјg}\xC5V3n6iʎtӜ~V+̝٫̼9X~(kurXW̋SV\VUsUqXq±=Vszs=W=^szs=W=^szs=W=^szs=W=^szs=W=^sz==W#?=WgooC+?./ ?:~"\+їtOa_S.۝!Ά{{Wz^{{WzIIs(J#'yzUa3Ta,ӬF[G&HIa]p>{Wz^{{Wz^{{Wz^{{Wz^{U¢7Lm̙_.>oo?jκ^GzatX7N|RvY2Nv<~瘤ߒI]P?>&k67Jݸ1+ҽyj24%E;rFTpAc5R/_([_<6"u֕:B / b6*Oh<Ls [GWPN?-T^?pBFFnkccXltyuSI34eGP}]NC;{le ,t;K(KK^O5U߄wk]/Q ߱T'3a5}Uv^PԂ+qXtZzjWR(<YG#A߽OWΘF@^bjEٚ9Pui<)*#$A;i,N?֯jE{K;4u9SMӼ:`ʡYN.KLX@VSreU\CCho ZM{f:sz걜_I'JYݏɑBP`뵵jɴR$BR: z׹&fOQBlA*tl>-P_C! C(hHT=ol[ك,N+ܬƧ0əbX )0JP?۲-}'Sd~_wmҕ+